Exercício de Genética - 2, Exercícios de Genética. Universidade Federal Fluminense (UFF)
beatriz_reis
beatriz_reis11 de Junho de 2016

Exercício de Genética - 2, Exercícios de Genética. Universidade Federal Fluminense (UFF)

DOCX (21.4 KB)
3 páginas
1Números de download
156Número de visitas
Descrição
Exercícios sobre ácidos nucleicos.
20pontos
Pontos de download necessários para baixar
este documento
baixar o documento

Exercício de Genética - 2

1. Diferencie duplicação na natureza e duplicação por PCR: R: A replicação consiste na produção de moléculas de DNA utilizando-se um molde de DNA e a principal enzima responsável pela polimerização é a DNA polimerase. Porém, essa enzima só consegue adicionar nucleotídeos sequencialmente em uma extremidade OH 3’ de uma fita já iniciada. Isso significa que a replicação cresce no sentido 5’->3’ e que as DNA polimerases não conseguem iniciar uma síntese, ou seja, adicionar um primeiro nucleotídeo sobre uma cadeia molde.

Para que a DNA pol comece uma polimerização é necessário que uma enzima adicione os primeiros nucleotídeos. Essa enzima é uma RNA polimerase especial que catalisa a síntese de um pequeno fragmento de RNA sobre a cadeia molde do DNA, o qual atua como iniciador para a DNA pol adicionar desoxirribonucleotídeos. O fragmento de RNA iniciador de uma cadeia de DNA é chamado de primer de RNA e a enzima que cataliza sua síntese é denominada RNA primase. A RNA primase atua no início da replicação, sintetizando o primer necessário para começar a síntese da cadeia leading, e também, durante todo o processo, sintetizando os primers necessários para o início da síntese de cada fragmento de Okazaki.

A técnica da PCR utiliza de uma DNA polimerase resistente a temperatura, a Taq polimerase, da bactéria Thermus aquaticus é usada para catalisar o crescimento a partir de primers de DNA. Com o uso da PCR, uma única cópia de um gene pode ser amplificada a partir de uma amostra genômica, desde que possam ser feitos os primers correspondentes às sequências do gene.

A PCR geralmente é útil em diagnóstico por DNA. A reação em cadeia da polimerase usa primers especificamente destinados a amplificar

determinadas regiões curtas do DNA sem clonagem

2. O que difere a transcrição nos procariontes da dos eucariontes? R: Procarioto e eucarioto => A transcrição começa em um ponto específico e termina em um ponto específico RNA polimerase – coordena o pareamento correto dos pares de acordo com a fita molde e catalisa a formação de ligações fosfodiesters entre os nucleotídeos O ribosso se liga na região promotora-> antecedendo o gen que vai ser traduzido

Procarioto Eucarioto O RNAm nem é totalmente transcrito e já está sendo traduzido

Uma única RNA polimerase para os tipos de RNA

Fator sigma-> encontra o ponto de início, e depois ele se desliga e ativa a Rna polimerase

DNA mais enxuto

O RNA é primeiro transcrito e depois se liga ao ribossomo

Tem 3 RNA polimerase

3. A replicação do DNA é conservativa ou semiconservativa? R: semiconservativa

4. Preencha a lacuna. Um filamento parenteral serve como molde para a síntese de um filamento- filho.

5. A polimerização do DNA ocorre pela adição de um desoxinucleotídeo a qual grupo químico? R: um grupo 3’-OH

6. Responda:

a) de que molde é feito o RNA? R: DNA bifilamentar. b) Com que enzima é feito o RNA? R: RNA polimerase.

c) É necessário um primer? R: não.

7. Quais grupos químicos estão presentes na origem e no término de uma molécula de mRNA que acabou de ser produzida? R: Um 5’-trifosfato e e uma 3’-OH

8. Quais as duas regiões mais comuns à maioria dos promotores procarióticos? R: -10 e -35 9. O que é um cap? R: É uma estrutura terminal encontrada na ponta 5’

10. Em que ponta do mRNA está o poli A? R: A ponta 3’-OH

11. O que são íntrons? R: São sequências não traduzidas que interrompem a sequência codificante de um transcrito, que são removidas antes que comece a tradução.

12. O que significa splincing de RNA? R: Remoção de íntrons e união de éxons.

13. O que é fita codante ou codificante? R: É a fita de DNA que será usada como molde para a transcrição, pois ela possui os fatores de transcrição que são proteínas específicas responsáveis por se ligar a sequências específicas do DNA (promotores) que caracterizam o local de início da transcrição e recruta RNA pol a esse sítio. OBS: promotores: Eucarioto = - 25 TATA e -75 CAAT Procariotos= -10 TAATTA e -35 TTGACA

14. Fale sobre projeto transcriptoma, integroma e proteoma. R: Projeto transcriptoma=> transforma RNAm em DNA pelos gens dos retrovírus que produzem transcriptase reversa (apresenta uma atividade RNA dependente, formando um cDNA - DNA complementar- ao RNAm. O RNAm é formado por exons.) Projeto proteoma=> sequenciamento das proteínas dos seres vivos. Projeto integroma => análise do projeto genoma, proteoma e transcriptoma

15. Por que hoje em dia o código genético é considerado quase universal? R: O código genético é seguido por todos os organismos vivos, o que possibilita a formação de organismos transgênicos. Esse código é universal. Porém hoje em dia ele é considerado quase universal, pois a mitocôndria tem uma pequena variação no DNA mitocondrial que pode ser por uma evolução da mitocôndria.

16. A partir da sequência abaixo de uma molécula de DNA: TACCGAACGATATGCCTCGGAGCCAAAATT

a. Construa RNAm e a proteína formada R: TACCGAACGATATGCCTCGGAGCCAAAATT => DNA

AUGGCUUGCUAUACGGAGCCUCGGUUUUAA => RNAm Met, ala, cys, try, thr, glu, pro, arg, phe, parada =>ptn

b. Diga quantos aminoácidos fazem parte da molécula de proteína: R: 9.

c. Se a sequência mudar para o citado abaixo, continuará a mesma proteína? A mudança foi de uma base nitrogenada ou de um códon?

TACCGAACGATAAAGCTCGGAGCCAAAATT R: TACCGAACGATAAAGCTCGGAGCCAAAATT => DNA

AUGGCUUGCUAUUUCGAGCCUCGGUUUUAA=> RNAm Met, ala, cys, try, thr, glu, pro, arg, phe, parada => ptn

17. O que significa dizer que o código genético é degenerado? R: Diz-se que o código genético é degenerado ou redundante por existirem vários codões que codificam o mesmo aminoácido. Por exemplo, os codões UCU, UCC, UCA e UCG codificam todos os aminoá cido Serina (Ser).

comentários (0)
Até o momento nenhum comentário
Seja o primeiro a comentar!
Esta é apenas uma pré-visualização
Consulte e baixe o documento completo
Docsity is not optimized for the browser you're using. In order to have a better experience we suggest you to use Internet Explorer 9+, Chrome, Firefox or Safari! Download Google Chrome