Primeira Lista de Exercícios - 2010 - Exercícios - Biologia Computacional, Notas de estudo de Biologia Computacional. Universidade Federal de Minas Gerais (UFMG)
Pao_de_acucar
Pao_de_acucar5 de Março de 2013

Primeira Lista de Exercícios - 2010 - Exercícios - Biologia Computacional, Notas de estudo de Biologia Computacional. Universidade Federal de Minas Gerais (UFMG)

PDF (543.3 KB)
2 páginas
803Número de visitas
Descrição
Apostilas e exercicios de Biologia Computacional, Primeira lista 2010.
20pontos
Pontos de download necessários para baixar
este documento
baixar o documento

MO640 – Biologia Computacional Primeiro Semestre de 2010 Primeira Lista de Exercícios

1) A seqüência abaixo (60 pb/linha) corresponde aos nucleotídeos 75.001 até 76.080 do gene de 90.660 pb que codifica a proteína Monoamina Oxidase A humana (NM_000240). Mutações neste gene foram associadas a comportamentos violentos, criminosos ou impulsivos. Este gene contém 15 éxons. Os éxons 7 (75.080-75.229) e 8 (75.533..75.692) estão destacado em letras maiúsculas. Uma forma de se isolar rapidamente este pedaço específico do genoma de muitos indivíduos seria amplificá-lo através de uma reação de PCR. Desenhe um par de primers, com 10 nucleotídeos cada, que amplifique um fragmento de 400-500 pb que contenha todo o íntron localizado entre os éxons 7 e 8. Destaque na sequencia abaixo o lugar onde os primers anelam. Indique o tamanho exato do amplificado obtido com o seu par de primers.

75001 ttttctaatc agtagccagt aggattttcc ttccttgggc tttcataatg tttcctttct

75061 tacctacctc ctcctgtagG AACGGAAGTT TGTAGGTGGA TCTGGTCAAG TGAGCGAACG

75121 GATAATGGAC CTCCTCGGAG ACCAAGTGAA GCTGAACCAT CCTGTCACTC ACGTTGACCA

75181 GTCAAGTGAC AACATCATCA TAGAGACGCT GAACCATGAA CATTATGAGG TAACTCAGTT

75241 TAGTCAAAAG GAGCATATAG TAAATAGGCC TTGTGTCTTT TGCAGTTTCT AACCAGATAt

75301 aattcaagca gtagcataat taatgctgac atgtttccgc ctcagtcttc caaattacca

75361 gccttggttg acctaccttg atctgttttg ttgcctcaca gttgcctcat tttctcattt

75421 tgtatgtttt tactgctcaa tgttgtttag aagtgataaa gatgattttt cacgcctgcc

75481 acaaagactg cagctcacat ttgaggtaat attttgcttg tgtgtgtttt agTGCAAATA

75541 CGTAATTAAT GCGATCCCTC CGACCTTGAC TGCCAAGATT CACTTCAGAC CAGAGCTTCC

75601 AGCAGAGAGA AACCAGTTAA TTCAGCGGCT TCCAATGGGA GCTGTCATTA AGTGCATGAT

75661 GTATTACAAG GAGGCCTTCT GGAAGAAGAA GGgtaggctg ctattattca tgtttaaact

75721 gtattatatg aagaaatcac agtcttttag gattattgaa cagaaggtat tgaacagaaa

75781 caaagtattt tcaaactggt agaaaaagga ttagaaatct tggtctgtca atttcctcat

75841 atccttggcc acacataatg accccaagag cacttgttgg caatgggagg gaagaaggag

75901 atcacatcag tcataaggcc accattgccc tgactcctgg catctgtcct gcttcttact

75961 ttttatgagc agagtgaggt caacaggcac catggaaaga gcactgcgtt gaagttacac

76021 attccgggac ttcgcttgct tgctagcatc agtctgtagc tgtaaagtgg tgacagtaat

2) Qual seria o tamanho exato do produto de PCR se os primers que você desenhou na questão de número 1 fossem empregados utilizando como molde o mRNA da Monoamina Oxidase A humana? 3) Genes e as proteínas por eles codificadas são colineares, i.e., a ordem dos aminoácidos nas proteínas é a mesma que os códons no RNA e DNA. Esta afirmação está correta? Por quê? 4) DNA humano tem uma porcentagem de 20% de Gs. Qual é a porcentagem de As, Ts e Cs? 5) DNA isolado do vírus M13 contém 25% de As, 33% de Ts, 22% de Cs e 20% de Gs. Estes resultados chamam a atenção de alguma forma? Por quê? Como você explicaria estes valores? 6) Uma vez que os íntrons são majoritariamente “lixo” genético, eles não precisam ser removidos com precisão do transcrito primário durante o splicing, certo? Explique. 7) Na micrografia eletrônica as moléculas de RNA Polimerase estão se movendo da direita para a esquerda, ou o contrário? Como é possível saber?

docsity.com

8) Partindo do DNA: GCATAATCGGTGCGTAGAGCATCAGAACCACGCATCTCAATACAACTGCCT, e imaginando uma reação hipotética de seqüenciamento que gerasse apenas 10 nucleotídeos como resultado, que primer de 6 nucleotídeos teria sido empregado na reação de seqüenciamento que gerou a figura abaixo?

G A T C

9) Os primeiros 10 nucleotídeos da molécula de mRNA de HBA2 (alfa-globina) são ACUCUUCUGG. Na molécula de DNA a seguir, aponte qual é a fita codante para o gene HBA2:

Fita + 5’TGACCAGAAGAGTCC3’

Fita – 3’ACTGGTCTTCTCAGG5’

docsity.com

comentários (0)
Até o momento nenhum comentário
Seja o primeiro a comentar!
Esta é apenas uma pré-visualização
Consulte e baixe o documento completo
Docsity is not optimized for the browser you're using. In order to have a better experience we suggest you to use Internet Explorer 9+, Chrome, Firefox or Safari! Download Google Chrome