Segunda Lista de Exercícios - 2009 - Exercícios - Biologia Computacional, Notas de estudo de Biologia Computacional. Universidade Federal de Minas Gerais (UFMG)
Pao_de_acucar
Pao_de_acucar5 de Março de 2013

Segunda Lista de Exercícios - 2009 - Exercícios - Biologia Computacional, Notas de estudo de Biologia Computacional. Universidade Federal de Minas Gerais (UFMG)

PDF (38.2 KB)
1 página
816Número de visitas
Descrição
Apostilas e exercicios de Biologia Computacional, segunda lista 2009
20pontos
Pontos de download necessários para baixar
este documento
baixar o documento
Pré-visualização1 página / 1
Microsoft Word - Lista1_Bioinfo.docx

MO640 – Biologia Computacional Primeiro Semestre de 2009

Segunda Lista de Exercícios 1) A seqüência abaixo (60 pb/linha) corresponde a parte inicial do gene da álcool desidrogenase humana. Este gene contém 9 éxons. O primeiro éxon (destacado em letras minúsculas) pode conter variações entre indivíduos. Uma forma de se isolar rapidamente este pedaço específico do genoma de muitos indivíduos seria amplificá-lo através de uma reação de PCR. Desenhe um par de primers, com 10 nucleotideos cada, que amplifique um fragmento de 100- 150 pb que contenha todo o éxon 1. Destaque na sequencia abaixo o lugar onde os primers anelam. Indique o tamanho exato do amplificado obtido com o seu par de primers. 1 GTGTTCAGTC CATACATACT AGTTTTGAGT GGAGCAGAAT TGCCAGGCAC AGTGATCCCC 61 TTTGCTGTGA CTAATTGGGT GTCTGATTCT CTGCTGTAAA GACAAAGAGG CTGCTCTCTC 121 TATCCTACTT CGTTTTTCCT GTTTTCTTAC TCTTCTTCCT TCCTCGCCAC CCCATGTGCA 181 TTCAAAGTTG CAGCTTAGTG CAGACAAAGG GAATACAAGG CAGAACGACC TATGTGGGAT 241 TGAAAGAAGA GAAACAAGGA ATTCCAGAGG CCGGGGGGGG GGTGGGAAGT GAGGAAAAGA 301 GAAAGTGATT ACAATTTATC ACTTTAACTT AATATTTAAA CTAATGAAAA CAAAATCTTA 361 TCTAGAATTT GGAAGTCAAT ATTTTGATTG CTGGTTCAGT ACCCTTTTAT CTGTTTTGAC 421 AGTCTGGGAA TAATCCAGTG GGTGTGGCTT AAAGACATAG ATCACGTGTG GAATTGGAAT 481 TGGATGTTAC ACAAGCAAAC AAAATAAATA TCTGTGCAAT ATATCTGCTT Tatgcactca 541 agcagagaag aaatccacaa agactcacag tctgctggtg ggcagagaag acagaaacga 601 catgagcacA GCAGGAAAAG TAAGCAAAAA ATATATTACT GTTGGTAATA TATTCTCATC 661 AATATAACAA AGAAAGGAAT ACAGTATTTG ATGAATAATT TAAAATTCAT ATCTAAATTA 721 GAAATGATAT GCTGAAATAT GATATGCAAT ATACACCTCA ATATGTAATG TATACTGAAC 781 TGCAG

2) Qual seria o tamanho exato do produto de PCR se os primers que você desenhou na questão de número 1 fossem empregados utilizando como molde o mRNA da álcool desidrogenase humana? 3) Partindo do DNA: GCATAATCGGTGCGTAGAGCATCAGAACCACGCATCTCAATACAACTGCCT, e imaginando uma reação hipotética de seqüenciamento que gerasse apenas 10 nucleotídeos como resultado, que primer de 6 nucleotídeos teria sido empregado na reação de seqüenciamento que gerou a figura abaixo? G A T C

4) Os primeiros 10 nucleotídeos da molécula de mRNA de HBA2 (alfa-globina) são ACUCUUCUGG. Na molécula de DNA a seguir, aponte qual é a fita codante para o gene HBA2: Fita + TGACCAGAAGAGTCC Fita – ACTGGTCTTCTCAGG 5) Uma reação de PCR consiste, normalmente, de 25 ciclos. Cada ciclo possui 3 etapas. Que etapas são estas (nomes), e o que ocorre em cada uma delas? 6) A possibilidade de empregar dideoxinucleotídeos fluorescentes em reações de seqüenciamento revolucionou esta técnica. O que é um dideoxinucleotídeo? Para quê ele serve na reação de seqüenciamento? Qual é a vantagem do uso de dideoxinucleotídeos fluorescentes?

docsity.com

comentários (0)
Até o momento nenhum comentário
Seja o primeiro a comentar!
Esta é apenas uma pré-visualização
Consulte e baixe o documento completo
Docsity is not optimized for the browser you're using. In order to have a better experience we suggest you to use Internet Explorer 9+, Chrome, Firefox or Safari! Download Google Chrome