Molecular Biology: Essential Components and Processes, Exams of Nursing

Download Molecular Biology: Essential Components and Processes and more Exams Nursing in PDF only on Docsity!

ASCP Molecular Biology Certification Exam| 321

questions| with complete solutions

Pyrimidine Correct Answer: One carbon ring Cytosine, Thymine, Uracil Purine Correct Answer: Two carbon rings Adenine, Guanine How are nucleotides joined together? Correct Answer: Condensation to form phosphodiester bond What is the function of mRNA? Correct Answer: Carries genetic info out of nucleus Transcript translated to protein What is the function of tRNA? Correct Answer: Carries aa to ribosome Anticodon pairs with codon on mRNA strand What is the function of rRNA? Correct Answer: part of ribosome structure most abundant RNA coordinated coupling of tRNA to mRNA codons Feedback inhibition Correct Answer: Product of pathway is noncompetitive inhibitor Binds to allosteric site to slow down rxn b/c too much product Exonucleases Correct Answer: Degrades nucleic acids by removing one terminal nt at a time Cleaves phosphodiester bond at end of chain 5' --> 3' and 3' --> 5' Endonucleases (Prok) Correct Answer: Restriction enzymes Cleaves phoshpodiester bonds w/i poly-nt chain Recognition site is palindromic sequence Types I-V ORI sites Correct Answer: nt sequence where replication is initiated Topoisomerase I Correct Answer: Induces ss breaks Remove DNA supercoils during TXN and DNA replication; for strand breakage during recombination; for chr condensation; and to disentangle intertwined DNA during mitosis topoisomerase II Correct Answer: cuts both strands of one DNA double helix, passes another unbroken DNA helix through it, and then reanneals the cut strands Gyrase (topoisomerase II) Correct Answer: Unwinds supercoiling caused by unwinding at the rep fork by introducing DSBs

Helicase Correct Answer: Breaks H-bonds of double helix at the replication fork Primase Correct Answer: DNApol α (DNA dep RNA pol) adds short segments of complementary RNA to ssDNA template (primers), serves as starting points for replication single-strand DNA binding proteins (SSBPs) Correct Answer: Binds ssDNA and prevents it from re-annealing during TXN, replication, repair, and recombination Okazaki fragments Correct Answer: Short fragments of DNA synthesized by DNApol δ using the lagging strand (3'->5') as a template Ligase Correct Answer: Closes gaps in DNA Catalyzes phosphodiester bond between 3'OH and 5'P What are the steps in DNA replication? Correct Answer: 1. Initiate

2. Elongate
3. Terminate Telomeres Correct Answer: Repeat sequence (TTAGGG) at the ends of chr, protect chr from degradation RNA polymerase Correct Answer: DNA dependent RNApol Transcribes DNA template to RNA (3'-->5'; anti-parallel) Splicesomes Correct Answer: Complex of snRNPs Removes introns from pre-mRNA and splices exons together Enhancers Correct Answer: Short regions of DNA that bind proteins (TXN factors) that enhance TXN of a gene Poly-A tail Correct Answer: Prevents mRNA from being degraded in cytoplasm 100-250 A's at 3' end 5' cap Correct Answer: 5'-5' pyrophosphate bridge to a methylated G added to 5' end of a mRNA Protects against degradation and as a recognition signal for TLN apparatus aminoacyl tRNA Correct Answer: tRNAs that carry amino acids Ribosomes Correct Answer: Where TLN occurs Prok: 30s and 50s Euk: 40s and 60s Catalyzes peptide bond between a.a.'s What is the path of a tRNA in a ribosome? Correct Answer: Acceptor > Peptidyl > Exit

How is translation initiated? Correct Answer: small rRNA (40S) subunit binds mRNA and scans for start codon (AUG) Met-tRNA is brought to the P site Large rRNA (60S) subunit binds How is translation terminated? Correct Answer: Occurs when stop codon enters A site Release factor recognizes stop codon, hydrolyzes ester bond with P site, releasing aa chain Reverse transcriptase Correct Answer: enzyme that transcribes RNA to cDNA (lacks introns) RNA --> RNA:DNA --> cDNA (dsDNA) Pleiotrophy Correct Answer: a single gene controls the expression of many phenotypic traits ie Sickle Cell Anemia cDNA Correct Answer: intron free complementary DNA can be inserted into a plasmid Vector Correct Answer: helps carry DNA into cell ie plasmids, virus Open Reading Frame (ORF) Correct Answer: sections of DNA that begin with start codons and end with stop codons DNA: 5' --> 3' transcription: 3' --> 5' DNA --> RNA (promoter) translation: 5' --> 3' mRNA Spectrophotometer Correct Answer: Measures amount of light absorbed Quantitative measurement of [DNA/RNA] At what wavelength does DNA and RNA absorb? Correct Answer: 260 nm At what wavelength does protein absorb? Correct Answer: 280 nm Organic isolation method Correct Answer: 1. Lyse

2. Add phenol/ chloroform > vortex/spin
3. Transfer aqueous layer (top) to new tube
4. Add chloroform:IAA (removes phenol) > vortex/spin
5. Transfer aqueous layer to new tube
6. Add NaOAc and EtOH > vortex/spin
7. Decant
8. Resuspend How do you inactivate RNases? Correct Answer: 200C for 2 hrs 30 min in 1M NaOH or quanidinum isothiocyanate

Hybridization Correct Answer: 2 ssDNA molecules of comp base sequence can form a ds hybrid (duplex) What does the incubation step in hybridization do? Correct Answer: Allows formation of ds molecules Blocking DNA (Hybridization) Correct Answer: minimizes probe binding to nonspecific sequence ie salmon sperm DNA, Human LINE- Blocking Proteins (Hybridization) Correct Answer: minimize nonspecific binding of probe to membrane ie casein (milk), Denhardt's sol Stringency Correct Answer: conditions of hybridization that control the specificity of binding of the probe to the target sequence How can you increase strigency in a hybridization? Correct Answer: decrease [salt] increase [formamide] increase temp Formamide acts as a __________ in a hybridization. Correct Answer: denaturing agent Line Probe Assay (LiPA) Correct Answer: reverse hybridization assay using sequence-specific oligonucleotide probes (reverse SSOP) multi-parameter testing --> single strip Line Probe Assay steps Correct Answer: 1. Isolate nucleic acid (RNA)

2. Amplify
3. Hybridization
4. Strigent wash
5. Incubate with conjugate
6. Incubate with substrate
7. Detect What method would you use if you knew the gene sequence and the mutation? Correct Answer: Reverse Dot Blot Microarrays Correct Answer: Used for unknown gene and mutation cDNA libraries can be used for gene expression, tumors, genetic mapping, mutations and polymorphism large scale, high throughput analysis Microarray steps Correct Answer: 1. isolate mRNA from cells
8. RT to get labeled cDNA copies of mRNA
9. cDNA washed over slide. cDNA sticks to comp sequence

4. use laser to read fluorescent tags Southern Blot Correct Answer: Detect a large DNA fragment among many Target: DNA, probe: DNA What can Southern Blots be used to detect? Correct Answer: Deletions/insertions Point mutations Polymorphisms Structural rearrangements Southern Blot steps Correct Answer: 1. RE digest to fragment DNA
5. Run on gel to separate
6. Soak gel in alkali/NaOH to denature dsDNA
7. Transfer ssDNA fragments to positively charged membrane (blot)
8. Fix to filter by heat (80C) or UV crosslink
9. Incubate (hybridize) blot w/ radioactively labeled ssDNA comp probe
10. Autoradiograph Heterduplex Analysis (HA) Correct Answer: use for known gene, unknown mutation mutation screening bands on gel --> retarded migration from WT due to seq differences Heterduplex Analysis steps Correct Answer: 1. PCR
11. Mix sample and CTR DNA together
12. Denature PCR using heat
13. Cool slowly to rt
14. Add denaturing loading buffer
15. Run on MDE gel Single-Stranded Conformational Polymorphism Ananlysis (SSCP) Correct Answer: Used for known gene, unknown mut Mutation screening Short PCR products form 3D conformation when cooled --> muts have different conformation than WT Non-denaturing PAGE, muts migrate different than WT What makes DNA negatively charged? Correct Answer: Phosphate groups of the phosphate:ribose backbone How does EtBr cause DNA to fluoresce? Correct Answer: Intercalates into the double helix Absorbs UV ~300 nm, emits ~600 nm TAE Buffer Correct Answer: tris-acetate w/ EDTA good for DNA recovery good for lrg fragments low buffering capacity

increases migration of DNA thru gel TBE Buffer Correct Answer: tris-borate w/ EDTA good for small DNA fragments high buffering capacity decreases migration thru gel Pulse Field Gel Electrophoresis steps Correct Answer: 1. culture

2. embed pellet in agarose plug
3. treat w/ lysozyme (cell lysis)
4. proteinase K
5. gel How can Tween 20 affect PCR? Correct Answer: Stabilizes Taq Suppress formation of 2* structures Increase yield Increase non-specific amplification What are some disadvantages of PCR? Correct Answer: Must know the sequence first Prone to contamination May not be 100% specific Specificity dependent on temp and [Mg] What is the purpose of primers in PCR? Correct Answer: to intiate replication What are the 3 steps of PCR and their temperatures? Correct Answer: Denature 90-96C Anneal 50-70C Extension 68-75C PCR process Correct Answer: 1. Prep MMx: buffer, taq, primers, dNTPs
6. Add target
7. Place in thermocycler
8. Denature dsDNA
9. Anneal: allows primers to hyb
10. Extend: pol adds dNTPs to 3'
11. Repeat steps 4- What can cause primer dimers? Correct Answer: annealing temp too low too much primer What are primer dimers? Correct Answer: Size is sum of two primers Primers hyb and are extended by Taq What can inhibit PCR amplification? Correct Answer: Detergent (SDS) Phenol (left over from DNA isolation) Heparin (specimen tube)

Heme Dyes CSF, urine, sputum, parafilm What is the use of uracil-N-glycosylase (UNG) in PCR? Correct Answer: Prevents contamination by destroying amplicons containing dUTPs What are some causes of too many bands on a gel after PCR? Correct Answer: Primers not specific Annealing temp too low Too many cycles Too much Mg++ RT-PCR Correct Answer: RNA --> cDNA first strand synthesis Bisulfite DNA sequencing/Methylation specific Correct Answer: 1. RE digest

2. Electrophorese and purify fragment of interest
3. Denature and incubate w/ sodium bisulfate (turns C>U, methylated C is unchanged)
4. clean, ppt, and resuspend
5. PCR --> sequence
6. Compare treated vs untreated, note where CG are not changed to TA How does PCR work with methylated DNA? Correct Answer: primers are designed to recognize methylated and unmethylated sense strands at gene promoter the methylated bases inhibit enzyme activity at recognition sites Ligase Chain Reaction (LCR) Correct Answer: Probe amplification Two adjacent primers are ligated and amplified by a 2nd set of primers if mutation is present at 3' end of upstream primer Can detect a 1 bp mis-match Which pathogens can LCR be used to detect? Correct Answer: Chlamydia Gonorrhea Listeria HPV Sickle cell dz Nucleic Acid Sequence Based Amplification (NASBA) Correct Answer: Isothermal, single tube rxn High sensitivity Enzymatic rxns take place concurrently NASBA steps Correct Answer: 1. Hybridize oligo-T7P primer to target seq
7. RT/RNase H
8. Hybridize with target-specific oligo primer (P2)

4. RNA transcript of T7 RNA pol What pathogens can you detect using NASBA? Correct Answer: HIV Hepatitis HTLV CMV Transcription-Mediated Amplification (TMA) Correct Answer: Two enzymes: RT and RNApol Isothermal RNA or DNA Strand Displacement Amplification (SDA) Correct Answer: 1st stage: target generated w/ RE site 2nd stage: probe amp; HincII nicks at RE site, DNApol extends/regenerates RE site and displaces strand high throughput high sensitivity Branched DNA (bDNA) Correct Answer: Signal amplification Target captured by probes on a solid support Extender, pre-amp, and amp probes hybridized Amp bind alkaline phosphatase Dioxetane is added as a substrate for chemiluminescence Measured with a luminometer What are the clinical uses for DNA sequencing? Correct Answer: Mutation detection Confirm mutation by other method Resistance testing HLA genotyping Do you have to know the gene sequence in order to do DNA sequencing? Correct Answer: Yes, in order to design primers You do NOT need to know the mutation Sanger sequencing method Correct Answer: Divided into 4 samples (ddA, T, G, C) Label with radioactive/dye oligo at 3' end Mix with taq, dNTPs, ddNTP and incubate run on gel --> frags will terminate at different lengths Why does Sanger sequencing use ddNTPs instead of dNTPs? Correct Answer: ddNTPs lack of a 3' OH which makes it impossible for pol to add more nucleotides --> chain termination ddNTP Correct Answer: dideoxyribonucleoside triphosphate lack a hydroxyl group (OH) at 2' and 3'

Fluorescent in situ hybridization (FISH) Correct Answer: Uses fluorescent probes to detect DNA sequences on chr What are some of the benifits of FISH? Correct Answer: Large number of cells may be scored Dual color --> multiple targets Many sample types What types of probes are used for FISH? Correct Answer: Dual fusion: 2 probes flank the breakpoint at both t locations CEN probes: centromeric probes bind to repetitive alpha satellite sequences Telomeric probes Whole chr paints What is the wavelength for background in spectrophotometery? Correct Answer: 320 nm How do you determine quality of DNA/RNA using a spectrophotometer? Correct Answer: A260/A What is considered good quality DNA/RNA from spectrophotometry? Correct Answer: DNA: 1.7-2. RNA: 2.0-2. What is considered poor quality RNA/DNA from spectrophotometry? Correct Answer: <1. Protein contamination What does smearing on a gel indicate? Correct Answer: Sample degradation Loaded too much How can you tell if you have good RNA using gel electrophoresis? Correct Answer: Good RNA will have a 2:1 intensity (28S : 18S) if 18S is more, RNA degradation is possible What is one way you can increase the yield/quality of DNA/RNA after running gel? Correct Answer: Do an EtOH ppt Which specimen tubes are the best for use with molecular assay? Correct Answer: EDTA (lavender/purple) ACD (yellow) Which specimen tubes are not good for use with molecular assays? Correct Answer: Heparin (brown/green) inhibits several enzymes used in molecular assays Should you freeze blood or bone marrow if you are going to use it in a molecular assay? Correct Answer: NO Room temp 22-25C

Neutrophils will degranulate if frozen What is the best temperature to store DNA? Correct Answer: Long term = -70C short term = -20C For long term storage, what should you store DNA in? Correct Answer: TE or DNase free H2O What is the best temperature to store RNA? Correct Answer: Long term = -70C short term = -20C Should you lyse RBCs before freezing? Correct Answer: YES After an extraction/isolation, what should you elute with? Correct Answer: DNA - TE or water RNA - DEPC water What are the two types of isolation/extraction methods? Correct Answer: Liquid phase (organic & inorganic) Solid phase (Qiagen) What some causes of DNA damage? Correct Answer: mutagens carcinogens cell death age-related decreases in DNA repair genetic disease Nucleotide Excision repair (NER) Correct Answer: Done by endonucleases Removes a span of nt's by cleaving phosphodiester bond Base Excision repair (BER) Correct Answer: Done by DNA glycosylase, AP endonuclease Cleaves glycosidic bond of a single base base, leaving apurinic/apyrimidinc site Diagnostic sensitivity Correct Answer: likelihood of positives Diagnostic specificity Correct Answer: likelihood of negatives Clinical sensitivity and specificity is based on _________. Correct Answer: outcome Analytical sensitivity is based on _____ and specificity is based on _______. Correct Answer: limit of detection target specificity What is direct analysis? Correct Answer: identifying a specific gene or mutation that caues disease. gene must be known, might need to know mut What are some direct analysis methods? Correct Answer: southern

PCR - ASO blot, restriction digest SSCP HA What some indirect analysis methods? Correct Answer: RFLP linkage analysis What is indirect analysis? Correct Answer: inherited marker near gene associated with disease unknown gene and /or mut Describe the growth of the nucleic acid chain Correct Answer: The chain grows by the attachment of the 5' phosphate group of an incoming nucleotide to the 3' hydroxyl group of the last nucleotide on the growing chain Denaturing agents Correct Answer: formamide, urea, mercaptoethanol Histones Correct Answer: Proteins that DNA tightly coils around to form chromosomes Octamer, 2 ea of: H2A, H2B, H3, and H Histones are hydrophobic (basic K & R,+) DNA is hydrophilic (P backbone, -) +/- interaction keeps them bound Solenoid Correct Answer: a coil of six nucleosomes wound into a tightly packed helix Mutation Correct Answer: DNA sequence change that is present in a relatively small proportion of the population <1%, somatic changes Variant Correct Answer: inherited sequence alterations Polymorphism Correct Answer: a change in the DNA sequence that is present in at least 1-2% of the population (ex. Sickle cell anemia) Gene mutations Correct Answer: affect single genes and are often small changes in the DNA sequence Chromosome mutations Correct Answer: Affects the structures of the entire chr, requires the movement of large chr regions Genome mutations Correct Answer: Change in the number of chr's Eupliod Correct Answer: normal complement of chromosomes Aneuploid Correct Answer: Increased number of chr's (eg. Down's syndrome) Haploid Correct Answer: Single copy of each chr (humans have 23)

Diploid Correct Answer: Two copies of each chr (humans have 46) DNA polymerase Correct Answer: Catalyzes phosphodiester bond between nt's Uses ssDNA as a template to determine which nt's to add DNA Polymerase I (Prok) Correct Answer: Processes Okazaki fragments Replaces RNA primers with DNA (exonuclease activity) Excision repair & proof reading DNA Polymerase II (Prok) Correct Answer: DNA repair, exonuclease activity DNA Polymerase III (Prok) Correct Answer: Primary enzyme involved in replication Exonuclease activity DNA Polymerase IV (Prok) Correct Answer: Bypass replication SOS response DNA Polymerase V (Prok) Correct Answer: Bypass replication SOS response Translesion synthesis DNA repair DNA Polymerase α (Euk) Correct Answer: Primase DNA dependent DNA & RNA pol DNA Polymerase β (Euk) Correct Answer: Base excision repair (BER) DNA Polymerase δ (Euk) Correct Answer: Lagging strand synthesis DNA repair, exonuclease, replaces primers as it encounters Okazaki fragments DNA Polymerase ε (Euk) Correct Answer: Leading strand synthesis exonuclease DNA Polymerase γ (Euk) Correct Answer: mtDNA replication and repair Exonuclease activity Terminal transferase Correct Answer: DNApol synthesizes poly-nt chain at 3' end w/o a template Transcription Correct Answer: initiation --> elongation --> termination Retrotransposons Correct Answer: Mobile genetic elements which can increase genome size and insert itself within coding/noncoding regions The three biochemical activities of reverse transcription Correct Answer: RNA-dependent DNApol, Ribonuclease H, and DNA-dependent DNApol --> all used to create ds cDNA from RNA

Describe the steps of reverse transctiption Correct Answer: 1. tRNA acts as a primer and hybridizes to virus genome

2. Complementary DNA then binds to the U5 (non-coding region) and R region
3. RNAse H degrades the 5' end of the RNA which removes the U5 and R region.
4. The primer then "jumps" to the 3' end of the viral genome and the newly synthesized DNA strands hybrid Exons Correct Answer: Gene sequences that represent codons used in TLN to protein Introns Correct Answer: Non-coding sequences that are spliced out before TLN Splicing Correct Answer: modification of the nascent pre-messenger RNA (pre-mRNA) transcript in which introns are removed and exons are joined. R-factors Correct Answer: resistance transfer factors. Carry antibiotic resistance to common antibiotics. Colicinogenic factors Correct Answer: resistance to bacteriocins, toxic proteins manufactured by bacteria. Primary protein structure Correct Answer: sequence of a chain of amino acids Secondary protein structure Correct Answer: Amino acids are linked by H bonds to form sub structures; eg a helixes, B sheets Tertiary protein structure Correct Answer: 3D structure of a single protein Quaternary protein structure Correct Answer: 3D structure of a multi sub unit protein Restriction enzymes Correct Answer: endonucleases that recognize specific sequences and break the phosphodiester bond of dsDNA Type I restriction enzymes Correct Answer: have both nuclease and methylase activity in a single enzyme. Bind to host-specific DNA that contains methylated adenines Type III restriction enzymes Correct Answer: resemble type I enzymes in their ability to methylate and restrict (cut) DNA. - adenine methylation occurs on only one strand. Type II restriction enzymes Correct Answer: used most frequently in the laboratory - do not have inherent methylation activity in the same molecule as the nuclease activity Exonuclease I Correct Answer: Degrades ssDNA from 3'-->5'

Exonuclease III Correct Answer: Removes 5' mono-nt's from the 3' end of the dsDNA in the presence of Mg2+ and Mn2+. Removes nucleotides from blunt ends, recessed ends, and nicks, but NOT overhangs! Exonuclease VII Correct Answer: Degrades ssDNA from either the 5' or 3' ends One of the few enzymes with 5' exonuclease activity. Deoxyribonuclease I Correct Answer: From bovine pancrease, digests ss and dsDNA at pyrimidines. Typically used to remove DNA from RNA preparations. Exonuclease II Correct Answer: Proofreading function of the pol Degrades ssDNA from 3'-->5' Southern Blotting Correct Answer: DNA is isolated and cut with REs. This allows investigators to determine the molecular weight of a restriction fragment and to measure relative amount in different samples. Southern Blotting Procedure Correct Answer: 1. RE digest DNA

2. Gel electrophoresis
3. Soak in HCl (depurinates, weakens H-bonds)
4. Soak in NaOH (denatures)
5. DNA transferred to a membrane
6. Immobilize (UV or bake)
7. Pre hyb to block
8. Hyb with probe SyBr green Correct Answer: Non-specific intercalation into the minor groove of dsDNA, can be used in qPCR Chaotropic agents Correct Answer: disrupts the structure and denatures the DNA by increasing the entropy and non-covalent forces like hydrogen bonds (ex. chemicals like - sodium iodide, or sodium perchlorate) TaqMan Correct Answer: Relies on the 5' exonuclease cleavage activity of Taq pol to cleave a dual labeled probe during hybridization to the complementary target sequence. Only emits a signal once separated from quencher. FRET probes Correct Answer: Fluorescence Resonance energy transfer - Distance dependent interaction between the electronic excited states of two dye molecules in which excitation is transferred from a donor molecule to an acceptor molecule without emission of a photon. Molecular beacons Correct Answer: Measures accumulation of product at the annealing step Contains target specific seq and inverted repeat that forms stem-loop At annealing step probe hyb's to target, separating R and Q

Scorpion probes Correct Answer: PCR prod is covalently bound to dye; primer is bound to molc beacon type seq After extension, target specific seq will unfold w/ the newly synthesized target seq, separating R and Q Components of PCR Correct Answer: DNA template Two primers that are complementary to the 3' Taq polymerase dNTPs Buffer solution Mg2+ (divalent cations) - higher Mn2+ concentration can increase the error rate during DNA synthesis Thermal Cycling steps in conventional PCR Correct Answer: 1. Initialization (94-96 C)

2. Denaturation (94-98 C)
3. Annealing (50-65 C)
4. Extension (70-80 C)
5. Repeat 2-4 ~30x
6. Final Elongation (70-74 C)
7. Final hold Optimization of PCR methods Correct Answer: 1. Check the Tm
8. Mg2+ concentration - too little can result in no PCR product, and too much may produce noise
9. PCR cycles
10. Add, extend, or increase the temp of the initial template denaturation step
11. Concentrations of other buffer components
12. GC Content Real-Time PCR/qPCR Correct Answer: PCR based method which is used to amplify and quantify a targeted DNA molecule. Enables both detection and quantification. The quantity can be either an absolute number of copies or a relative amount when noramalized to the DNA input. PCR DNA Array Correct Answer: DNA array is a collection of spots attached to a solid support (such as a microscope slide) where each spot contains one or more ssDNA oligo fragments. Arrays make it possible to put down large quantities of very small spots on a single slide. Each spot has a DNA fragment that is complementary to a single DNA sequence. Reverse Transcriptase PCR Correct Answer: Used to detect RNA expression levels. RT-PCR is used to qualitatively detect gene expression through creation cDNA transcripts from RNA. Branched DNA Technololgy (bDNA) Correct Answer: used for DNA or RNA; short probes are used to capture the target nucleic acid and then to multiple reporter molecules, loading the target nucleic acid with signal.

Sequence Based Nucleic Acid Amplification (NASBA) Correct Answer: Used to amplify RNA sequences; Primer-dependent technology that can be used for the continuous amplification of nucleic acids in a single mixture at one temperature; works at 41 C Transcription Mediated Technology (TMA) Correct Answer: uses RNase H which degrades RNA from the intermediate hybride so denaturing is no longer required; Isothermal process - negates the requirement for thermal cycling to drive rxns. Targeting RNA allows for the direct detection of RNA viruses (HCV, HIV). Strand Displacement Amplification (SDA) Correct Answer: after the initial denaturation step the reaction proceeds at one temperature. Normally used for M. tuberculosis, C.trachomatis, and N. gonorrhoeae. Loop-mediated isothermal amplification (LAMP) Correct Answer: Isothermal, single tube technique for the amplification of DNA Uses 4 different primers that recognize 6 regions on target gene Stem-loop structure forms which is used as a template for lamp cycling (SDA) Hybrid capture assays (HCA) Correct Answer: Signal amplification Target DNA is released from the cell, denatured, and binds RNA probe DNA:RNA is recognized and binds Ab on solid support DNA:RNA are detected by adding Abs that bind w/ AP, substrate is added Ligase Chain Reaction (LCR) Correct Answer: Ligation of 2 adjacent primers, which uniquely hyb to one strand of the target Upstream 3' end coincides w/a potential single bp diff in the target sequence If the ends match -> ligated by ligase -> act as a template for the next step 2nd set of primers that are complementary to 1st set -> amplification via pcr probe amp = mutation no probe amp = no mutation Cleavase/Invader Correct Answer: Invader & signal probe added to target Cleavable substrate is formed if mutation is present Signal probe is cleaved to form invader in the next step FRET probe is added; if invader hybridizes, cleavase cuts flap, separating R and Q Sanger Sequencing Correct Answer: Known as deoxy chain terminating sequencing; A primer complementary to the 5' region of DNA is used. The primer is typically labeled with P (internal labeling) or a fluorescent dye. Here, modified ddNTPs derivatives are added which lack the OH group found on the 3' carbon of the dNTPs. DNA synthesis will stop upon incorporation of a ddNTP because the bond between the phosphodiester bond cannot be established. Illumina sequencing (NextGen) Correct Answer: DNA molecules and primers are attached on a slide and amplified with polymerase to form DNA clusters. Four types of reversible terminator bases (RT-bases) are added an the non-incorporated nucleotides are washed away. Images are

taken of the fluorescently labeled nucleotides as the sequence extends, then the dye, along with the terminal 3' blocker allowing for the next cycle to begin. IonTorrent sequencing (NextGen) Correct Answer: Uses standard sequencing chemistry, but a semiconductor based detection system. Based on the detection of hydrogen ions that are released during the polymerization of DNA as opposed to the optical methods. A microwell containing a template DNA is flooded with a single type of nucleotide (A,T,G,C) and if the nucleotide is complementary to the template it is incorporated into the growing strand of DNA. This causes the release of hydrogen ions that triggers the sensor. SOLiD Sequencing (NextGen) Correct Answer: Sequencing by ligation. A pool of all possible oligonucleotides of a fixed length are labeled according to the sequenced position. The oligonucleotides are annealed and ligated, the preferential ligation by DNA ligase for matching sequences results in a signal informative of the nucleotide at that position. Before sequencing, the DNA is amplified by emulsion PCR and the resulting beads (each containing single copies of the same DNA) are deposited on the glass slide for sequencing. Dye terminator Correct Answer: ddNTPs are used and fluorescently labeled instead of the primer. All four reactions are performed in the same tube. Terminated nucleotides are amplified. Dye primer Correct Answer: Four different fluorescent dyes are added to the primers. Cycling is done to attach the primer and that is what the instrument sees. Each nucleotide is amplified a different color. Too many and too few ddNTPs result in: Correct Answer: too many ddNTPS will result in many short sequence reads, too little will result in loss of sequencing data but will give a longer read. Pyrosequencing Correct Answer: No gels, fluorescent dyes, sequencing ladder, or ddNTPS; Pyrophosphate (PPi) is released when the phosphodiester bond forms between the dNTP and the primer and is converted to ATP. The ATP then generates a luminescent signal by luciferase- catalysed conversion of luciferin to oxyluciferin. This is repeated with each of the nucleotides - the generation of a signal indicates which nucleotide is the correct base in the sequence. GTTAC (dG peak, dT peak (double that of dG), dA peak, dC peak. Most useful for short to moderate sequencing analysis, or SNPs. Used in HLA Maxam-Gilbert Sequencing Correct Answer: Differing concentrations of salt are used in four different tubes - A, T, C, G - Usually DMS (dimethylsulphate), FA (formic acid), H (hydrazine), and H+S (hydrazine + salt) --> read on a gel Bisulfate DNA sequencing Correct Answer: A type of chain termination sequencing designed to detect methylated nucleotides. Methylation of cytosine residues in DNA is an important part of gene regulation and expression - this is important for detecting different types of cancer. During the incubation C is converted to U and 5-methylated C is unchanged. A PCR reaction is then performed using normal chain termination methods.

Denaturing High-performance Liquid Chromatography (HPLC) Correct Answer: Analysis for PCR products 150-450 bp. The heteroduplexes elute ahead of the homoduplexes as the conditions intensify. The migrating homoduplexes are detected by absorbance at 260nm or fluorescence. Melt Curve Analysis Correct Answer: Used for SNPs; Specimens with identical sequences should yield the same peak at the expected Tm and specimens containing different sequences will yield two or more peaks. (FRET Probes - dissociation curves) Nucleic Acid labeling Correct Answer: Common labels used to generate nucleic acid probes include radioactive phosphates, biotin, fluorophores and enzymes. In addition, the bioconjugation methods used for nucleic acid probe generation may be adapted for attaching nucleic acids to other molecules or surfaces to facilitate targeted delivery or immobilization, respectively. In-situ hybridization Correct Answer: Used to detect protein, RNA, and DNA within the cell. Probes bind to the DNA and can be visualized under the microscope. Depending on the mutation, different signals can be seen - deletions and duplications. Sensitivity can be increased by using dual fusion probes, break apart probes, centromeric probes, and telomeric probes. Dual fusion probes Correct Answer: Uses two pairs of probes with different fluor dye Bind regions that span the breakpoint of both t partners If t is present, signal from both dyes should be present Break apart probes Correct Answer: Bind to the chr flanking the t breakpoint region WT will emit a combination signal (next to each other) and t will emit separated signals. Centromeric probes (CEN) Correct Answer: designed to hybridize to the high alpha satellite sequences surrounding centromeres. Region specific to detect aneuploidy of chromosomes Telomeric probes Correct Answer: Best for cryptic translocations or small abnormalities Single-strand conformation polymorphism (SSCP) Correct Answer: Based on the preference of DNA to exist as DS rather than SS; Forms 3D conformers - a SNP can cause the conformer to fold differently (kinks, loops, bubbles, and tails) Restriction fragment length polymorphism (RFLP) Correct Answer: Used to detect sequence alteration in retriction enzyme fragments; The region surrounding the mutation is amplified and the mutation is detected by cutting the amplicon with the correct restriction enzyme Analyte specific reagent (ASR) Correct Answer: FDA defines analyte specific reagents (ASRs) in 21 CFR 864.4020 as "antibodies, both polyclonal and monoclonal, specific receptor proteins,ligands, nucleic acid sequences, and similar reagents which, through specific binding or chemical reaction with substances in a specimen, are intended to use in a diagnostic application for identification and quantification of an individual chemical substance or ligand in biological specimens.

research use only (RUO) Correct Answer: According to FDA, manufacturer-initiated studies of RUO products are typically intended to evaluate design, limited-scale performance, and issues such as usability of the test. The agency acknowledges that RUO products may be used for non- clinical laboratory research for goals other than developing a commercial IVD product. According to FDA, these uses may include developing novel and fundamental medical knowledge related to human disease and conditions. In-vitro diagnostics (IVD) Correct Answer: Medical devices intended to perform diagnoses from assays in a test tube, or more generally in a controlled environment outside a living organism. lab developed tests (LDT) Correct Answer: a term used to refer to a certain class of in vitro diagnostics (IVDs). In the United States, the Food and Drug Administration has determined that while such tests qualify as medical devices, FDA will allow these products to enter the market without prior approval from the Agency. CLIA Correct Answer: Congress passed the Clinical Laboratory Improvement Amendments (CLIA) in 1988 establishing quality standards for all laboratory testing to ensure the accuracy, reliability and timeliness of patient test results regardless of where the test was performed. The Joint Commission Correct Answer: An independent, not-for-profit organization, The Joint Commission accredits and certifies more than 20,000 health care organizations and programs in the United States. Joint Commission accreditation and certification is recognized nationwide as a symbol of quality that reflects an organization's commitment to meeting certain performance standards. CAP Correct Answer: The College of American Pathologists (CAP), is a medical society serving more than 18,000 physician members and the global laboratory community. It is the world's largest association composed exclusively of board-certified pathologists and pathologists in training and is the worldwide leader in laboratory quality assurance. The College advocates accountable, high-quality, and cost-effective patient care. CMS Correct Answer: Previously known as the Health Care Financing Administration (HCFA), is a federal agency within the United States Department of Health and Human Services (DHHS) that administers the Medicare program and works in partnership with state governments to administer Medicaid, the State Children's Health Insurance Program (SCHIP), and health insurance portability standards. In addition to these programs, CMS has other responsibilities, including the administrative simplification standards from the Health Insurance Portability and Accountability Act of 1996 (HIPAA), quality standards in long-term care facilities (more commonly referred to as nursing homes) through its survey and certification process, and clinical laboratory quality standards under the Clinical Laboratory Improvement Amendments. CLSI Correct Answer: Clinical Laboratory and Standards Institute; A not-for-profit membership organization, the Clinical and Laboratory Standards Institute (CLSI) brings together the global laboratory community for a common cause: fostering excellence in laboratory medicine. We do

so by facilitating a unique process of developing clinical laboratory testing standards based on input from and consensus among industry, government, and health care professionals. FDA Correct Answer: FDA is responsible for protecting the public health by assuring the safety, efficacy and security of human and veterinary drugs, biological products, medical devices, our nation's food supply, cosmetics, and products that emit radiation. also responsible for advancing the public health by helping to speed innovations that make medicines more effective, safer, and more affordable and by helping the public get the accurate, science-based information they need to use medicines and foods to maintain and improve their health. Methylation of cytosine bases 5' to the gene will increase or decrease expression? Correct Answer: decrease Histone acetylation close to the gene will increase or decrease expression? Correct Answer: increase siRNAs complementary to the gene transcript will increase or decrease expression? Correct Answer: decrease Calculate the DNA concentration from the following: 260=0.172 (D.F. 1:100) Correct Answer: 860 ug/mL = .172 abs * 50 ug/mL * 100 DF [DNA] = 1535 ug/mL. You have 0.5 mL. What is the total yield. Correct Answer: 767.5 ug = 1535 ug/mL * 0.5mL [DNA] = 767.5 ug/mL. You have 0.5 mL What is the total yield. Correct Answer: 383.75 ug = 767.5 ug/mL * 0.5 mL [DNA] = 860 ug/mL. You have 0.5 mL. What is the total yield. Correct Answer: 430 ug = 860 ug/mL * 0.5mL Calculate the RNA concentration from the following: 260=0.307 (DF 1:100) Correct Answer: 1228 ug/mL = 0.307 abs * 40 ug/mL * 100 DF An RNA preparation has the following readings: 260=0. 280=0. Is this RNA suitable for use? Correct Answer: Yes, 2.17 is suitable for RNA analysis A260/A280 = 0.208/0. How does PFGE separate larger fragments more efficiently than standard electrophoresis? Correct Answer: Repeated reorientation forces larger fragments through the gel matrix more efficiently If fragments are dissolved in 50% formamide will the stringency be higher or lower? Correct Answer: Higher

If fragments are dissolved in a high concentration of NaCl will the stringency be higher or lower? Correct Answer: Lower Does heating a solution from 65C to 75C during hybridization raise or lower stringency? Correct Answer: raises What would the autoradiogram show if the stringency was to high? Correct Answer: no bands Calculate the Tm of the following primers: Forward: GGAGCTTTGTTTCAACCAAG Reverse: ATTAAATGCGGAATTGCCCA Correct Answer: Forward: Tm=(4C x 9GC)+(2C x 11AT) = 58C Reverse Tm=(4C x 8GC)+(2C x 12AT) = 56C Is 47;XXY a normal karyotype? Correct Answer: No, this is XXY syndrome What is the genetic abnormality of: 47,XY,+18 Correct Answer: Trisomy 18: Edwards Syndrome What is the genetic abnormality of: 46,XY,del(16p14) Correct Answer: Deletion in region 1, band 4 of the short arm of chr 16 What is the genetic abnormality of: iso(X)(q10) Correct Answer: Isochormosome comprised of the long arms of the X chr What is the genetic abnormality of: 46, XX, del(22q11.2) Correct Answer: Deletion in region 1, band 1, sub-band 2 of the long arm of chr 22 (diGeorge's syndrome) What is the genetic abnormality of: 45, X Correct Answer: Monosomy X, Turner's syndrome Acrocentric Correct Answer: A chr where the with a centromere not in the middle, but closer to one end or the other A small portion of chr 2 has been found on the end of chr 15 and a small portion of chr 15 was found on the end of chr 2. This mutation is called a: Correct Answer: Reciprocal translocation Why is the lectin, phytohemagglutinin (PHA), added to a cell culture when preparing cells for karyotyping? Correct Answer: Stimulates mitosis in the cells A CEN probe is used to visualize chr 21. Three fluorescent signals are observed in the patient's cells when they are stained. These results are consistent with what chr disorder? Correct Answer: Trisomy 21, Down's syndrome

Name 3 assays by which Factor V Leiden R506Q mutation can be detected: Correct Answer: Sequence specific PCR, PCR-RFLP, Invader Assay What are two biological exceptions to positive identification by autosomal STR? Correct Answer: Identical twins and clones have identical nuclear DNA profiles Hemoglobinopathies Correct Answer: A group of inherited disorders in which there is abnormal production or structure of the Hb molecule. Such disorders include hemoglobin C disease, hemoglobin S-C disease, sickle cell anemia, and various types of thalassemia. Thalassemias Correct Answer: An inherited blood disorder where the body makes an abnormal form of Hb, the protein in RBCs that carries O. The disorder results in excessive destruction of RBCs --> anemia. Mutations or del of the α or β genes Sickle cell anemia Correct Answer: An inherited blood disorder where RBCs form a rigid disc or crescent shape HbS: β6Glu>Val HbSS: sickle cell anemia Coagulopathies Correct Answer: Disorder of blood coag caused by inherited or acquired defects in coag proteins, platelets, or vasculature e.g. Von Willebrand's dz, hemophilia, Factor V Leiden Factor V Leiden Correct Answer: 1q25, F5 gene 1691G>A, R506Q Causes deep vein thrombosis Treated with anticoagulants (warfarin/Coumadin) Prothrombin Correct Answer: G20210A A bleeding disorder that slows the blood clotting process. Mutations in the FII gene cause prothrombin deficiency. Methylenetetrahydrofolate reductase Correct Answer: 1p36.3, MTHFR gene; C677T (A222V), A1298C (E429A) Methylenetetrahydrofolate reductase catalyzes conversion of MTHF--> 5-MTHF which is converted to Met Thromboembolism, homocysteine builds up, Met is depleted Fragile X syndrome Correct Answer: Xq27 FMR1, CGG repeat 5' UTR causes methylation Mental retardation WT repeats 5-55, carrier 56-200, mutation 200-2000+ Dx: PCR, S. blot for full mutation Huntington disease (HD) Correct Answer: 4p16.3 HD/HTT; CAG repeat

CAG repeat in HD/HTT causes multiple Q's at 5' of Huntingtin protein. Protein aggregates in plaques (especially in nervous tissue) slowing down brain function; symptoms appear at 30+ yo; impaired judgement, slurred speech, difficulty swallowing, intoxicated appearance WT repeats 9-37, HD 38-86 repeats Dx: PCR, S.blot to resolve full mut Muscular dystrophy (DMD/BMD) Correct Answer: Xp21, dystrophin gene; XR Causes muscle weakness and muscle loss DMD: non-functional protein made BMD: some function of protein is retained Cystic fibrosis (CF) Correct Answer: 7q31.2 CFTR gene; F508del; AR Cl channel membrane protein Affects cells that produce mucus, sweat, saliva, and digestive juices; causes thick secretions Dx: RFLP, PCR-RFLP, HD, Invader, SSP-PCR Gaucher's disease Correct Answer: 1q21 GBA; AR N370S or L444P Lipid, glucosylceramide, accumulates in WBCs, liver, spleen, lungs, bone marrow and, less commonly, brain, caused by a deficiency of the enzyme glucocerebrosidase, which helps the body process the fatty substance glucocerebroside. Dx: PCR ->seq coding region Hereditary hemochromatosis Correct Answer: 6p21.3 HFE; C282Y, G>A; AR a genetic disease that causes the body to absorb and store too much iron Treatment: phlebotomy Prader-Will syndrome Correct Answer: del(15)(q11q13) paternal; maternal is imprinted Congenital dz, mental retardation, short stature, obesity, hypogonadism Angelman syndrome Correct Answer: del(15)(q11q13) maternal; paternal is imprinted Ataxia, seizures, inappropriate laughter Histocompatibility Correct Answer: A state or condition in which the absence of immunological interference permits the grafting of tissue or the transfusion of blood without rejection. Trastuzumab (Herceptin) Correct Answer: Treats Her2/Neu/ErbB2+ (17q12 over expression) breast cancer. mAb binds extracellular domain of EGFR receptors, blocking mitogen binding Warfarin (Coumadin) Correct Answer: Anticoagulant, prevents thrombosis thromboembolism VCORC1: -Group 1: fast metabolizers/high dose -Group 2: slow metabolizers/low dose CYP2C9: SNPs cause slow metabolism/low dose Clopidogrel (Plavix) Correct Answer: Antiplatelet agent

Activated by CYP2C19 CYP2C19 poor metabolizers at high risk of treatment failure, death, heart attack, and stroke Carbemazepine (Tegretol) Correct Answer: Treat bipolar disorder, seizures, neuropathic pain Dangerous/fatel skin rxns w/ HLA alleles: HLA-B*1502 HLA-B58 Qβ replicase Correct Answer: Probe amplification Target (ssDNA/RNA) and to tube w/ reporter probe (has QB reporter Target:reporter hyb to capture probes > complex is hyb to capture probe with magnetic bead > complex is bound to well and washed Target:reporter released > QBpol is added > probe is amplified and detected via colorimetric or flurogenic methods Detects: mycobacteria, Chlamydia, HIV, CMV Burkitt's lymphoma Correct Answer: t(8;14)(q24;q32), c-myc;IgH t causes c-myc to be constitutively expressed > unregulated proliferation (clonal B cell expansion) Follicular lymphoma Correct Answer: t(14;18), IgH;Bcl-2 WT Bcl2 regulates apoptosis t causes overexpression of Bcl2 > immortal cell (clonal B cell expansion) Most common indolent N.H.L. Dx: PCR w/ primers for MBR/MCR & J regions Mantle cell lymphoma (MCL) Correct Answer: t(11;14)(q13;q32), Cyclin D1;IgH Cyclin D1: needed for cell cycle t causes overexpression of cyclin D1 > clonal expansion of B lymphocytes Dx: FISH, CT/PET scan for high glucose metabolism spots Acute lymphoblastic leukemia (ALL) Correct Answer: t(12;21) TEL-AML1 fusion t(9;22)(q34;q11) BCR-ABL fusion (Philly chr) Abl is a Tyr kinase; t causes Abl to be constitutively expressed > unregulated lymphoblast proliferation Common in children Dx: karyotyping, IHC, S.blot, RT-PCR, q-PCR Treatment: Imatinib (Gleevec), Tyr kinase inhibitor Acute myeloid leukemia (AML) Promyelocytic (APL) Correct Answer: t(8;21) RUNX1/RUNX1T1 Common in adults; myeloblasts 'freeze' in current state (don't differentiate) & proliferates forming a clonal population Dx: Flow cytometry, FISH Treatment: Chemo., BM transplant APL

t(15;17) PML;RARα, Promyelocytic leukemia protein;Retinoic acid receptor alpha Chronic myelogenous leukemias (CMLs) Correct Answer: t(9;22) Abl;Bcr (Philly chr) BCR-ABL constitutively active > activates Jak/Stat; inhibits apoptosis > unregulated proliferation of myeloid cells Clonal expansion of myeloid cells in BM Dx:Karyotype, FISH, RT-PCR Treatment: Imatinib (Gleevec) Chronic lymphoid leukemia (CLL) Correct Answer: del(17)(p913) TP53 del(11)(q22) ATM del(13q) long arm clonal b-call malignancy, progressive accumulation of mature lymphocytes Most common leukemia Dx: Flow cytometry; 'basket' or 'smudge' lymphocytes Treatment: chemo., BM transplant Endonucleases (Euk) Correct Answer: Cleaves phoshpodiester bonds w/i poly-nt chain DNase I: induces DSBs AP endonuclease: BER Tay Sachs disease Correct Answer: 15q, HEXA gene; AR 1278insTATC, exon 11 Insufficient hexoaminidase A activity; GM2-gangliosides cannot be broken down and accumulate in the brain; causes cerbral degeneration and blindness A-DNA conformation Correct Answer: Right-handed Deep narrow major groove, wide shallow minor groove Dehydrated DNA takes this form B-DNA conformation Correct Answer: Right-handed Wide major groove, narrow minor groove Common form found in cells Z-DNA conformation Correct Answer: Left-handed caused by stress or torsion (e.g. during transcription) Human papillomavirus (HPV) Correct Answer: Types 16 and 18 cause most cervical cancers Major histocompatibility complex (MHC) Correct Answer: Group of genes located on 6p MHC gene products are called human leukocyte antigens (HLA) HLA class I Correct Answer: HLA-A, HLA-B, HLA-C Expressed on all nucleated cells Composed of an α and β-2 chain (Domains:α1, α2, α3) Polymorphisms located on chr 6, exon 2 and 3