Download ASCP Practice Exam Questions: Genetics and Molecular Biology and more Exams Nursing in PDF only on Docsity!
ASCP PRACTICE EXAM QUESTIONS
LATEST UPDATED VERIFIED
GUARANTEED PASS 202 4 /202 5
ACCURATE
Mutation in what gene is associated with Fragile X syndrome? FMR Mantle cell lymphoma (MCL) is caused by what translocation? t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments Okazaki fragments What gene is measured following treatment with imatinib (Gleevec)? FLT BCR/Abl Jak MAPK BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second 50 nucleotides per second This polymerase is involved in "replicates mitochondrial DNA":
Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single- gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22 - 25ºC 2 - 8ºC
- 20ºC
- 70ºC
- 70ºC Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 75°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR?
faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: Pleiotrophy What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR NASBA Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: Thymine What genes would be screened in a breast cancer panel? HER2, ERBB2, BRCA Next Generation Sequencing uses: Short sequence reads Purines and pyrimidines differ from each other in that: Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine Adenine and guanine What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs
1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs 1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the molecule Nucleotide sequence of the molecule Nucleotide sequence of the molecule What are the phases in a qPCR Amplification Plot? Initiation, exponential, plateau Baseline, exponential, plateau Baseline, threshold, exponential, plateau Baseline, initiation, threshold, exponential, plateau Initiation, exponential, plateau Find the palindrome in this restriction enzyme site: 5'-CTGCAG-3'? 5'-GAC 3'-GAC 3'-CTG 5'-GTC 3'-GAC A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single- gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient has Huntington Disease, HD. Which of the following would be consistent with this diagnosis? 25 CAG repeats in the Huntington gene 85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene 85 CAG repeats in the Huntington gene Which two HPV types are responsible for most cases of cervical cancer? 16 and 18 31 and 59
RNA Pol II What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase Qβ replicase This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I Type III What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap Poly-A tail 5' Methionine Cap 5' Methyl Cap A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% 50% The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA --> RNA --> Proteins DNA -->Proteins --> Genes RNA --> DNA --> Proteins RNA --> Proteins --> DNA DNA --> RNA --> Proteins
What drug is NOT metabolized by CYP2D6? Codeine Omeprazole Warfarin Escitalopram Warfarin You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation Frame-shift mutation A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% 100% Which DNA polymerase is responsible for copying DNA by reading existing strand, building new complementary strand and always adds to 3' end, but can't start a new strand on its own (ORI sites)? DNA Polymerase III DNA Polymerase I Gyrase None of the choices listed DNA Polymerase III How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log 1log 2log 3log
3' to 3' complementarity of primer pairs The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? C1' C2' C3' C4' C3' Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors that that can influence this process. G:C ratio of bases pH of the hybridization reaction Hybridization temperature All of the above All of the above A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: 76.35 micrograms/mL 3817.5 micrograms/mL 381.75 micrograms/mL 3054.0 micrograms/mL 3817.5 micrograms/mL Mutation in UGT1A1 affects metabolism of what drug? Ironotecan Testing for HOXB13, BRCA1 and BCRA2 is usually done in patients with: Prostate cancer RT-PCR can be used to quantify messenger RNA (mRNA) among other uses. All of the following concerning RT-PCR are true, EXCEPT: RT-PCR is useful in detecting RNA-viruses, such as HIV RT-PCR uses alkaline phosphatase to reverse amplify the signal RT-PCR produces cDNA using RNA templates RT-PCR uses alkaline phosphatase to reverse amplify the signal Southern blot can be used for all of the following purposes, except: Paternity testing Chromosomal staining
Gene discovery and mapping Mutation analysis and identification Chromosomal staining If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer? A vegetarian diet Never having been pregnant Obesity Smoking Smoking Which of the following is not a common hydrogen bond acceptor? A carbonyl Primary amine Hydroxyl Tertiary amine Primary amine T-Cell Gene Rearrangement is seen in what malignancy? Sézary syndrome Burkitt's lymphoma Non-Hodgkin Lymphoma Polycythemia vera Non-Hodgkin Lymphoma The t(11;22) translocation is responsible for: Ewing sarcoma In CML, what fusion protein is created? EWS-FLI EWS-PAR BCR-Abl c-myc-IGH BCR-Abl As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task? Nested PCR
NASBA
LCR
PCR
During DNA replication, the 3' - OH of the growing DNA chain attacks which phosphate of an incoming nucleotide? Alpha Beta Gamma Delta Beta What gene is measured following treatment with Warfarin? FLT VKORC MAPK P VKORC The process of making proteins is termed: Replication Translation Transcription Sequencing Translation How many polymorphisms can be found in the human genome? Approximately 10 million Approximately 100 thousand Approximately 1 billion Approximately 1 million Approximately 10 million This highly polymorphic loci region is crucial in assessing immune system compatibility: VNTRs HLA SINES SNPs HLA Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 5'-ATCTATGTCGGCAATT-3'
5'-TTAACGGCTGTATCTA-3'
5'-AATTGCCGACATAGAT-3'
5'-GAGCACGCTATCTTAT-3'
5'-ATCTATGTCGGCAATT-3'
Mutations in the CFTR gene is associated with what disease? Fragile X Cystic Fibrosis Sickle-cell anemia Mantle Cell Lymphoma Cystic Fibrosis The mother of a 3 year old boy took him to the doctor's office for concerns of an underlying genetic condition. A karyotype order was sent to the Molecular Diagnostic lab. Karyotype results show 47, XY,+21. Based on these results, the boy has: Patau Syndrome Down Syndrome Edward Syndrome Cri du chat Syndrome Down Syndrome In real-time PCR, what is amplified? The target The signal The probe All of the above The target When sequencing HLA-DR what is targeted? Exon 1 of the α subunit Exon 2 of the α subunit Exon 1 of the β subunit Exon 2 of the β subunit Exon 2 of the β subunit What is the rate of DNA translation? 80 nucleotides per second 200 nucleotides per second 60 nucleotides per second 40 nucleotides per second 60 nucleotides per second
- When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored.
- At the melting point, the probe separates from the target strand and fluorescence rapidly decreases.
- The melting temperature of double stranded DNA depends on its base composition and length.
- All PCR products for a specific primer pair should have the same melting temperature. Acute promyelocytic leukemia (APL) is responsible for what translocation? t(15;17) What genes would be screened in a colorectal panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA KRAS, EGFR, ALK MSH2, PMS2, EPCAM KRAS, BRAF, PIK3CA What responds poorly to Ribavarin/Interferon treatment? HCV type 1 HCV type 2 HCV type 3 HCV type 4 HCV type 1 & 4 HCV type 2 & 3 HCV type 1 & 4 If two parents are heterozygous for an autosomal recessive disease, then their offspring will most likely follow this gene frequency pattern:
- 25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive
- 50% homozygous dominant, and 50% homozygous recessive
- 100% homozygous for the dominant phenotype
- 100% homozygous for the recessive phenotype 25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive This polymerase acts on DNA and produces Transfer RNA: RNA Pol II DNA Pol II RNA Pol III DNA Pol III RNA Pol III
What assay is a signal amplification test and uses Alkaline Phosphatase? Branched DNA TMA PCR NASBA LCR Branched DNA What genes would be screened in a lung cancer panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA KRAS, EGFR, ALK MSH2, PMS2, EPCAM KRAS, EGFR, ALK Which of the following molecular methodologies would be the best for detecting a trinucleotide repeat disorder such as Huntington's disease? Heteroduplex analysis Variable number tandem repeat analysis Single strand conformation polymorphism analysis Reverse-Transcriptase PCR Variable number tandem repeat analysis Which method would best be used to detect the Leiden mutation? PCR-RFLP bDNA amplification PFGE Ribotyping PCR-RFLP Which of the following is not a step in the Southern blot procedure? DNA digest with restriction enzymes Gel resolution of fragments Fragments denaturation Probe digest Probe digest Bone marrow transplantation is a great method used to treat several malignant and benign cancers, particularly leukemias. Before transplantation (or engraftment analysis), several polymorphic loci are screened in both the recipient and donor cells. The main goal of this screening is to:
5'-AATTGCCGACATAGAT-3'
5'-GAGCACGCTATCTTAT-3'
5'-ATCTATGTCGGCAATT-3'
What is the optimum storage condition for any specimen (whole blood, bone marrow, tissue etc.) awaiting RNA extraction?
- Remove contaminating RBCs then immediately freeze at - 20°C
- Prepare a lyophilized cell pellet and store at room temperature
- Refrigerate at 4°C indefinitely Remove contaminating RBCs then immediately freeze at - 20°C Which of the following is not a PCR step? Denaturation Elongation Annealing Termination Termination Which PCR method has the highest specificity? qPCR Touchdown PCR Nested PCR Two-step PCR Nested PCR All of the following enzymes are part of the DNA replication machinery, EXCEPT: Ligase DNA polymerase Luciferase Helicase Luciferase What is the name of the molecule that is added to the 5' end of eukaryotic RNA transcripts? ATP SnRNP GTP Phosphate GTP What is multiplex PCR?
- A PCR technique to amplify multiple targets
- A PCR technique where a preamplified amplicon is amplified to increase sensitivity
- A PCR technique where a preamplified amplicon is amplified to increase sensitivity
A PCR technique that combines reverse transcription and amplification in one reaction
- A PCR technique where various samples can be amplified in one reaction A PCR technique to amplify multiple targets Codons that code for the same amino acid are called: Synonyms Similar Degenerates Complements Synonyms When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as approximately: ΔCt = 1 ΔCt = 3. ΔCt = 10 ΔCt = 6. ΔCt = 3. Deletion in the paternal chromosome 15: del(15)(q11q13) results in Prader-willi syndrome. However, deletion in the same region in the maternal chromosome results in a completely different condition known as Angelman syndrome. This phenomenon is an example of: Mosaicism Loss of heterozygosity Hemizygosity Genomic imprinting Genomic imprinting What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer? t(18;X) Testing for Aldehyde Dehydrogenase deficiency is important in patients with: Alcohol dependence Diabetis Lactic acidosis Obesity Alcohol dependence You could use all of the following methods to test for the the t(9;22) translocation, except: FISH Southern blot Reverse-transcriptase PCR Ribotyping
