Bio 151 Final Exam Review updated 2023 updated, Exams of Biology

Download Bio 151 Final Exam Review updated 2023 updated and more Exams Biology in PDF only on Docsity! Bio 151 Final Exam Review updated 2023 What type of bond links amino acids into a protein chain - correct answer peptide bond What are the three components of a nucleotide? - correct answer Sugar, phosphate group, nitrogenous base What will determine whether a particular chain of amino acids is hydrophobic or hydrophilic? - correct answer The R-groups in that part of the peptide If a hydrophilic signal like insulin is intended to pass its signal to the nucleus inside a cell it will pass through the membrane to get to the DNA - correct answer false When a cell divides and the daughter cell changes (so for instance the inner cell mass divides and some start to differentiate as part of the future reproductive system) the DNA gets changed - correct answer false What does a kinase do? - correct answer Adds a phosphate to another protein In the absence of cyclin, CDK - correct answer Does not bind target proteins or phosphorylate anything What happens to G1/S cyclin before S phase - correct answer It's ubiquitinated How might a ubiquitin inhibitor affect the cell cycle? - correct answer Proteins inappropriate for the given phase might continue to be phosphorylated What does cdk do directly during S phase? - correct answer Phosphorylates proteins leading to DNA replication Why is bi-orientation - each sister chromatid attached to a different centrosome so important? - correct answer It ensures that each cell gets a sister chromatid You have a template strand of DNA that reads: 5' -ATCGTCGGCC -3' Pick the correct mRNA that would be transcribed from this template strand DNA - correct answer 5' - GGCCGACGAU - 3' If the coding strand of DNA has the sequence 5′-CGAGACTTCTGA-3′, what will the sequence of the transcribed mRNA be? - correct answer 5′-CGAGACUUCUGA-3′ If a particular DNA sequence has a cytosine content of 25%, what is its adenine content? - correct answer 25% There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by the fact that - correct answer the rules for base pairing between the third base of a codon and tRNA are flexible. What would be the effect if the A had been deleted instead of changed? 5' CUGACUCCUGAGGAGAAGTCT 3' to 5' CUGACUCCUGGGAGAAGUCU 3' - correct answer the protein wouldn't work There would be a frameshift mutation Rank the types of control in terms of speed of response (1 is fastest): - correct answer 1 Post-translational, 2 translational, 3 transcriptional Which of the following does not happen in prokaryotes, but does in eukaryotes? - correct answer Chromatin remodeling The restrictive temperature for a temperature sensitive mutant is the temperature when - correct answer It can no longer grow, survive or flourish From the reading (a week ago, but still from the reading). A reaction is considered to be spontaneous when - correct answer Its ΔG < 0 What way could a cell drive an endergonic reaction? - correct answer Couple it to the hydrolysis of ATP --> ADP + Pi An enzyme can change an endergonic reaction to an exergonic one - correct answer false How many aqueous compartments are there in the chloroplast? - correct answer 3 Can Glycolysis proceed in the absence of Oxygen (O2)? - correct answer yes What is the net "yield" of glycolysis in ATP per glucose molecule? - correct answer 2 ATP per glucose Which of the following statements about NAD+ is true? - correct answer NAD+ is reduced to NADH during glycolysis What is the GROSS "yield" of glycolysis in ATP per glucose molecule? - correct answer 4 ATP per glucose