Study with the several resources on Docsity
Earn points by helping other students or get them with a premium plan
Prepare for your exams
Study with the several resources on Docsity
Earn points to download
Earn points by helping other students or get them with a premium plan
Community
Ask the community for help and clear up your study doubts
Discover the best universities in your country according to Docsity users
Free resources
Download our free guides on studying techniques, anxiety management strategies, and thesis advice from Docsity tutors
A comprehensive set of questions and answers covering various aspects of biochemistry, including dna structure, protein structure, and enzyme function. It is a valuable resource for students studying biochemistry at the university level, offering a comprehensive review of key concepts and principles.
Typology: Exams
1 / 89
The nucleotide sequence that is complementary to 3'-CGATCT-5' is __________. - Answers-5'-GCTAGA-3' What cofactor does DNA polymerase use? - Answers-Mg 2+ What is a difference between RNA and DNA? - Answers-RNA may have enzymatic activity while DNA never does How many chromosomes are present in a human cell in G2-phase of the cell cycle? - Answers- 92 Which one of the following structures has a prominent major groove? - Answers-B-form of DNA What is Chargaff s rule? - Answers-The quantity of guanine equals that of cytosine and the number of adenines equals that of thymines. What does a lactose repressor protein do? - Answers-It binds DNA to regulate transcription of genes What is a consequence of Lysines 4, 9, 14, 18 on the N-terminus of Histone 3 being acetylated? - Answers-The lysines sidechains will no longer be positively charged What are cofactors? - Answers-They are small molecules present at the active sites of proteins that are critical for an enzymatic reaction to happen. What carbon on the ribose sugar has an extra hydroxyl group that is absent in deoxyribose? - Answers-carbon 2 What is a function of the tails of core histone proteins that stick out of nucleosomes? - Answers-They are modified to form a code that impacts what happens with the packaged DNA What is the function of the centromere? - Answers-it is the DNA sequence to which a kinetochore protein complex attaches What causes the lac repressor to be released from DNA? - Answers-an allosteric change caused by the binding of lactose What type of bond stabilizes a beta-sheet structure in a protein? - Answers-Hydrogen Bonds To what part of DNA do histone proteins bind? - Answers-They bond to the negatively charged phosphate groups on the outside of the DNA double helix
What happens when histone 1 is added to chromatin? - Answers-DNA is packaged more tightly How many chromosomes are present in human cells that are in the G1 phase? - Answers- 46 Approximately how long is a hydrogen bond? - Answers-3 angstroms An example of a covalent bond is... - Answers-the bonds that keep nucleotides attached to each other in a single strand of DNA How does an RNA binding protein recognize an RNA molecule with a specific sequence
Why are histone proteins positively charged? - Answers-because they contain many lysine and arginine amino acids Which of the following is an example of enzymatic reactions facilitated by RNA? - Answers-formation of the peptide bond Which proteins are present in the histone core? - Answers-Histones 2A, 2B, 3 and 4 What structure can the following RNA sequence form? : 5 CCAGGAGAACCCAAUCCUGG 3 - Answers-a hairpin loop If DNA is tightly packaged so that it can fit inside the nucleus how can genes be transcribed? - Answers-The proteins that package DNA slide up and down the DNA to expose protein binding sites. What protein ensures that sister chromatids remain attached to each other? - Answers- cohesin The nucleotide sequence that is complementary to 5'-CGATCT-3' is __________. - Answers-5'-AGATCG-3' What is a special property that the amino acid proline has? - Answers-It disrupts alpha- helices in proteins what is the hydrogen bond acceptor within a peptide bond? - Answers-the carbonyl group What is a function of the telomere? - Answers-Distinguish between broken DNA and the end of the chromosome Why does DNA form a double helix? - Answers-to maximize van der Waals interactions between adjacent bases Why do DNA sequences with a high guanosine:cytosine content have higher melting temperatures? - Answers-Because guanosine:cytosine base pairs are connected with three hydrogen bonds while adenosine;thymine base pairs are linked with only two. What is a pseudogene? - Answers-A gene that lacks a promoter sequence Which amino acid is enriched in histone proteins? - Answers-arginines An example of a cofactor is - Answers-Mg2+ in DNA polymerase Which organism below has the highest gene density? - Answers-E. coli
Proteins that recognize specific DNA sequences often - Answers-Hydrogen bond with specific base pairs trough the major groove of the DNA double helix What protein packages a chromosome very tightly during the M phase? - Answers- condensin What does a telomere consist of? - Answers-it consists of a repeating 6 basepair sequence. Myoglobin - Answers-What protein is used for storage? Myoglobin Hemoglobin Collagen Transferrin It's a covalent interaction - Answers-What is NOT TRUE of antibodies with respect to protection? It is a covalent interaction It's a noncovalent interaction; hydrogen bonding Aspartic acid pKa=3.9 - Answers-What is the amino acid that would dissociate a proton and make it ionizable in physiological pH? Aspartic acid pKa= 3. Histidine pKa= 6 Lysine Planar - Answers-What is the configuration of a peptide bond? Peptide bonds need to be intact - Answers-What do you have to have to make a protein denaturation reversible? Peptide bond needs to be intact Hydrogen bonds Disulfide Bonds Quaternary structure KEY WORD: SUBUNITS - Answers-What is the spatial arrangement of amino acids and functional subunits? Tertiary structure Primary structure Secondary structure Quaternary structure Primary structure - Answers-Which structure is predominantly responsible for a protein's 3D structure of amino acids and provides protein with function? Primary structure Secondary structure
Tertiary structure Quaternary structure Insulation - Answers-What is NOT considered one of the characteristics of amino acids? Support Protection Insulation High binding affinity Deprotonated, Protonated - Answers-In the amino acid structure, the carboxylic group is ___ and the amino group is ___. Protonated, Deprotonated Deprotonated, Protonated As pH decreases, the charge will become negative - Answers-What is NOT TRUE of the pH and charge complementarity? Changes in charge affects protein function. As pH decreases, the charge will become negative As pH decreases, the charge will become more positive As pH increases, the charge will become more negative. Hydrophobic - Answers-The interior of the protein is? None of these Hydrophobic Polar Glutamic acid - Answers-What is the amino acid at the N-terminus, EGAK? Lysine Glutamic Acid Disulfide bonds - Answers-What covalent interaction is the primary structure of proteins stabilized by? Hydrogen Bonding Ionic interactions Van der Waals Disulfide Bonds Phenylalanine, Tyrosine - Answers-What 2 amino acids are considered aromatic? Hemoglobin - Answers-What contains a quaternary protein structure?
Zero kinetic order - Answers-At high [S], what reaction order are you in?
a. Glycogen b. Homoglycan c. Heteroglycan d. Oligosaccharide Starch - Answers-4. In which of the following forms is glucose stored in plants? a. Glycogen b. Starch c. Dextrin d. Cellulose Glycogen - Answers-5. In which of the following forms is glucose stored in the liver? a. Glycogen b. Starch c. Dextrin d. Cellulose Glycogen - Answers-6. Which of the following is analogous to starch? a. Cellulose b. Glycogen c. Sucrose d. Chitin Hexokinase - Answers-7. Which of the following enzyme catalyzes the first step of glycolysis? a. Hexokinase b. Pyruvate Kinase c. Glucokinase d. Phosphofructokinase I Fermentation - Answers-8. The general term used for the anaerobic degradation of glucose to obtain energy is? a. Anabolism b. Oxidation c. Fermentation d. Metabolism Phosphofructokinase 1 (It is a regulatory enzyme and a major point of regulation) - Answers-9. Whenever the cell's ATP supply is depleted, which of the following enzyme's activity is increased? a. Hexokinase b. Pyruvate kinase c. Glucokinase d. Phosphofructokinase I
c. An aldose and a ketose (Glyceraldehyde 3-phosphate & dihydroxyacetone phosphate) - Answers-10. Cleavage of Fructose 1,6-biphosphate yields a. Two aldoses b. Two ketoses c. An aldose and a ketose (Glyceraldehyde 3-phosphate & dihydroxyacetone phosphate) d. Only a ketose b. Oxidation of glyceraldehyde 3-phosphate to 1,3-biphosphoglycerate - Answers-11. The first step in the payoff phase of glycolysis is? a. Reduction of 1,3-biphosphoglycerate to glyceraldehyde 3-phosphate b. Oxidation of glyceraldehyde 3-phosphate to 1,3-biphosphoglycerate c. Reversible conversion of dihydroxyacetone phosphate to glyceraldehyde 3- phosphate d. Irreversible conversion of dihydroxyacetone phosphate to glyceraldehyde 3- phosphate Hexokinase - Answers-12. High concentration of glucose 6-phosphate is inhibitory to? a. Hexokinase b. Pyruvate kinase c. Glucokinase d. Phosphofructokinase I 3 - phosphoglycerate - Answers-13. The product formed in the first substrate level phosphorylation in glycolysis is? a. Pyruvate b. 3-phosphoglycerate c. 1,3-biphosphoglycerate d. 2-phosphoglycerate Glucose into pyruvate - Answers-14. Glycolysis converts? a. Glucose into pyruvate b. Glucose into phosphoenolpyruvate c. Fructose into pyruvate d. Fructose into phosphoenolpyruvate Pyruvate dehydrogenase - Answers-15. Enzyme involved in the pathway of synthesis of acetyl-CoA a. Hexokinase b. Pyruvate decarboxylase c. Pyruvate dehydrogenase d. Pyruvate kinase NAD+ - Answers-16. In the reduction of pyruvate to lactate, which of the following is regenerated? a. H+
b. NADH c. NAD+ d. Na+ Gluconeogenesis - Answers-17. When blood sugar levels fall, glycolysis is halted in liver to allow? a. Homeostasis b. Anaerobic respiration c. Aerobic respiration d. Gluconeogenesis It is stimulated by AMP and ADP - Answers-18. Which of the following statements is true about PFK-1? a. It is stimulated by AMP and ADP b. It is stimulated by citrate and ATP c. It is inhibited by AMP and ADP d. It is stimulated by citrate and ADP a. From the hydrolysis of tri-acyl-glycerol, fatty acids can be used as a carbon source - Answers-1. Which of the following statements is FALSE about gluconeogenesis? a. From the hydrolysis of tri-acyl-glycerol, fatty acids can be used as a carbon source. b. From red blood cells, lactate can be used as a carbon source c. From the hydrolysis of tri-acyl-glycerol, glycerol is converted to glucose in gluconeogenesis d. From muscle vigorous muscle activity, lactate can be used as a carbon source Malate dehydrogenase - Answers-2. Oxaloacetate is reduced to malate by a. Pyruvate carboxylase b. Malate dehydrogenase c. Pyruvate kinase d. Phosphofructokinase- 1 Pyruvate to glucose - Answers-3. Gluconeogenesis involves conversion of a. Glucose to pyruvate b. Pyruvate to glucose c. Phosphoenolpyruvate to glucose d. Pyruvate to fructose a. 4 ATP, 2 GTP, and 2 NADH - Answers-4. Formation of one molecule of glucose from pyruvate requires a. 4 ATP, 2 GTP, and 2 NADH b. 3 ATP, 2 GTP, and 2NADH c. 4 ATP, 1 GTP, 2 NADH d. 2 ATP, 2 GTP, and 2 NADH
Alanine - Answers-5. The main source of glucose carbons for glucose carbons for gluconeogenesis is a. Guanine b. Alanine c. Cysteine d. Threonine c. Glucose- 6 - phosphatase hydrolyzes glucose 6-phosphate to release glucose into the blood - Answers-6. Which of the following statements about gluconeogenesis is correct? a. Pyruvate is first converted to phosphoenolpyruvate by phosphoenolpyruvate b. Fructose 1,6-biphosphatase converts fructose 1,6-biphosphate into fructose c. Glucose- 6 - phosphatase hydrolyzes glucose 6-phosphate to release glucose into the blood d. Glucose 6-phosphatase hydrolyzes glucose 6-phosphate and is found in liver and muscle True - Answers-7. Anaerobic glycolysis can produce ATP at a much faster rate than aerobic oxidative phosphorylation. a. True b. False Aldol condensation - Answers-8. Which of the following types of reaction does NOT occur in glycolysis? a. Isomerization b. Nucleophilic attack c. Aldol condensation d. Oxidation e. Dehydration Three strongly exergonic, nonequilibrium reactions - Answers-9. Glycolysis is regulated primarily by: a. The availability of glucose- 6 - phosphate b. Three strongly endergonic, nonequilibrium reactions c. Three strongly exergonic, nonequilibrium reactions d. Allosteric effectors of pyruvate kinase e. Phosphorylation of phosphofructokinase e. ATP decreases the Km for its substrate fructose- 6 - phosphate - Answers-10. Which of the following statements about regulation of phosphofructokinase is FALSE? a. AMP is an activator b. ADP is an activator c. Citrate is an inhibitor d. Fructose 2,6-biphosphate is an activator e. ATP decreases the Km for its substrate fructose- 6 - phosphate
False - Answers-11. All of the reactions of both glycolysis and gluconeogenesis occur in the cytosol. a. True b. False False - Answers-12. The flux rate through the gluconeogenic pathway is directly proportional to the amount of carbohydrate in the diet. a. True b. False True - Answers-13. Much of the regulation of gluconeogenesis is a result of the inhibition of glycolysis. a. True b. False Leucine - Answers-14. Which of the following cannot be used as a precursor for gluconeogenesis? a. Glycerol b. Pyruvate c. Lactate d. Leucine e. Alanine Liver - Answers-15. The primary gluconeogenic organ in animals is: a. Skeletal muscle b. Kidney medulla c. Kidney cortex d. Liver e. Heart muscle Lactate - Answers-16. ____ from muscle working anaerobically is released to blood and can be taken up by liver where it is converted to pyruvate by the enzyme lactate dehydrogenase. a. Lactate b. Pyruvate c. Glucose True - Answers-Both glycolysis and gluconeogenesis are controlled by fructose-2,6- biphosphate in response to hormones. a. True b. False True - Answers-Glycogen is a major energy source for skeletal muscle contraction a. True b. False
Hormonal control - Answers-Gluconeogenesis responds to which of the following? a. Hormonal control b. pH control c. Temperature control d. Blood control Gluconeogenesis - Answers-When blood sugar levels fall, glycolysis is halted in liver to allow a. Homeostasis b. Anaerobic respiration c. Aerobic respiration d. Gluconeogenesis 7 - Answers-How many steps are catalyzed by same enzymes in both glycolysis and gluconeogenesis? a. 6 b. 7 c. 8 d. 9 3 - Answers-22. How many steps are catalyzed by different enzymes in glycolysis and gluconeogenesis? a. 2 b. 3 c. 4 d. 5 Stimulated by AMP and ADP - Answers-23. Which of the following statements is true about PFK-1? a. It is stimulated by AMP and ADP b. It is stimulated by citrate and ATP c. It is inhibited by AMP and ADP d. It is stimulated by citrate and ADP Fructose 2,6-biphosphate - Answers-24. Which of the following is a potent regulator of glycolysis and gluconeogenesis? a. Fructose 2,6-biphosphate b. Fructose 1,6-biphosphate c. Fructose 6-phosphate d. Glucose 1,6-biphosphate Muscle phosphorylase - Answers-1. McArdle's disease is due to the deficiency of? a. Glucose- 6 - phosphatase b. Phosphofructokinase c. Liver phosphorylase d. Muscle phosphorylase
All of the above - Answers-2. Uridine diphosphate glucose (UDPG) is? a. Required for metabolism of galactose b. Required for synthesis of glucuronic acid c. A substrate for glycogen synthase d. All of the above c. Protein primer for glycogen synthesis - Answers-3. Glycogenin is? a. An uncoupler of oxidative phosphorylation b. Polymer of glycogen molecules c. Protein primer for glycogen synthesis d. Intermediate in glycogen breakdown 6 and 11 - Answers-4. The branching enzyme acts on the glycogen when the glycogen chain has been lengthened to between glucose units: a. 1 and 6 b. 2 and 7 c. 3 and 9 d. 6 and 11 Glucokinase - Answers-5. Hexokinase has a high affinity for glucose than? a. Fructokinase b. Galactokinase c. Glucokinase d. All of the above Phosphorylase - Answers-6. Glycogen is converted to glucose- 1 - phosphate by? a. UDPG transferase b. Branching enzyme c. Phosphorylase d. Phosphatase UDP glucose - Answers-7. The tissues with the highest total glycogen content are? a. Glucuronic acid b. Pyruvic acid c. UDP glucose d. Sorbitol Pyruvate - Answers-8. A regulator of the enzyme glycogen synthase is? a. Citric acid b. 2,3-biphosphoglycerate c. Pyruvate d. GTP UTP - Answers-9. An essential component for converting glucose to glycogen in liver is? a. Lactic acid
b. GTP c. CTP d. UTP Brain - Answers-10. Glycogen is present in all body tissues except? a. Liver b. Brain c. Kidney d. Stomach Dextrin - Answers-11. A polysaccharide which is often called animal starch is? a. Glycogen b. Starch c. Insulin d. Dextrin Cyclic AMP - Answers-12. Glycogen synthetase activity is depressed by? a. Glucose b. Insulin c. Cyclic AMP d. Fructokinase Glycogen phosphorylase a - Answers-13. One of the following enzymes does NOT change glycogen synthase a to b. a. Glycogen synthase kinases 3,4, b. Ca2+ calmodulin phosphorylase kinase c. Ca2+ calmodulin dependent protein kinase d. Glycogen phosphorylase a 300 - Answers-14. The total glycogen content of the body is about ___ grams. a. 100 b. 200 c. 300 d. 500 Glycogen - Answers-15. During starvation, the 1st reserve nutrient to be depleted is? a. Glycogen b. Proteins c. Triglycerides d. Cholesterol Glycogenolysis - Answers-16. The process of breakdown of glycogen to glucose in the liver and pyruvate and lactate in the muscle is known as? a. Glycogenesis b. Glycogenolysis c. Gluconeogenesis
d. Cellular degradation UDP - Answers-17. The pathway of glycogen biosynthesis involves a special nucleotide of glucose. In the reaction below, NuDP stands for NuDP Glucose + glycogen NuDP + glycogen+ a. ADP b. GDP c. UDP d. CDP a. Amylo [14][16] transglucosidase - Answers-18. In glycogenesis, a branch point in the molecule is established by the enzyme a. Amylo [14][16] transglucosidase b. Alpha 14 glucan transferase c. Amylo 16 glucosidase d. Glycogen synthase b. Glucose 6-phosphate glucose 1-phosphate - Answers-19. In the synthesis of glycogen from glucose the reversible step is? a. Glucose glucose- 6 - phosphate b. Glucose 6-phosphate glucose 1-phosphate c. Glucose 1-phosphate UDP d. UDP glucose glycogen a. Glucose 6-phosphatase - Answers-20. Von gierke's disease is characterized by the deficiency of? a. Glucose 6-phosphatase b. Alpha 14 glucosidase c. 16 glucosidase d. Liver phosphorylase b. Glucose 6-phosphate - Answers-21. Allosteric activator of glycogen synthase is? a. Glucose b. Glucose 6-phosphate c. UTP d. Glucose 1-phosphate Mg2+ - Answers-22. Action of glycogen synthase is inhibited by? a. Insulin b. Glucose c. Mg2+ d. Cyclic AMP Insulin - Answers-23. The hormone activating the glycogen synthase activity is? a. Insulin b. Glucagon
c. Epinephrine d. ACTH a. Alpha 1,4-glycosidic bonds - Answers-24. Glycogen synthetase catalyzes the formation of? a. Alpha 1,4-glycosidic bonds b. Alpha 1,6-glycosidic bonds c. Both A & B d. None of the above Glucagon - Answers-25. Glycogenolysis is increased by? a. Glucagon b. Insulin c. Epinephrine d. cAMP Glucagon - Answers-26. hepatic glycogenolysis is increased by? a. Insulin b. Glucagon c. Epinephrine d. Glucocorticoids c. Glucose 1-phosphate - Answers-27. Glycogen phosphorylase liberates the following from glycogen a. Glucose b. Glucose 6-phosphate c. Glucose 1-phosphate d. Maltose Muscles - Answers-28. Glucose 1-phosphate liberated from glycogen cannot be converted into free glucose in? a. Liver b. Kidneys c. Muscles d. Brain Succinate dehydrogenase - Answers-1. The only membrane bound enzyme in the citric acid cycle is a. Succinate dehydrogenase b. NADH dehydrogenase c. ATP synthase d. Acyl co-A dehydrogenase FMN - Answers-2. Which of the following is the prosthetic group of NADH dehydrogenase? a. NADH
b. FAD c. NADPH d. FMN a. Same as that normally produced by succinate - Answers-3. If mitochondria were blocked at the site of NADH oxidation and were treated with succinate as substrate, what would the P:O ratio be? a. Same as that normally produced by succinate b. One more than normally produced by succinate c. One less than normally produced by succinate d. Zero c. Increased inorganic phosphate in the mitochondria - Answers-4. If the oxidative phosphorylation was uncoupled in the mitochondria then there is a/an? a. Decreased concentration of ADP in the mitochondria b. Decreased oxidative rate c. Increased inorganic phosphate in the mitochondria d. Decreased production of heat a. Succinate oxidation remains normal - Answers-5. If rotenone is added to the mitochondrial electron transport chain a. Succinate oxidation remains normal b. P:O ratio of NADH is reduced from 3:1 to 2: c. Oxidative phosphorylation is uncoupled at site 1 d. Rate of NADH oxidation is diminished to 2/3 of its initial value d. Substrate reacts to form a product containing a high energy bond - Answers-6. Which of the following takes place in substrate level phosphorylation? a. Oxidation of one molecule of substrate is linked to synthesis of more than one ATP molecule b. High energy intermediate compounds cannot be isolated c. Only mitochondrial reactions participate in ATP formation d. Substrate reacts to form a product containing a high energy bond a. Only proton transport is strictly regulated, other positively charged ions can diffuse freely across the mitochondrial membrane - Answers-7. Chemiosmotic hypothesis does not involve a. Only proton transport is strictly regulated, other positively charged ions can diffuse freely across the mitochondrial membrane b. ATPase activity is reversible c. Proton flow in to the mitochondria depends on the presence of ADP and Pi d. Electron transport by the respiratory chain pumps protons out of the mitochondria O2 - Answers-8. Out of the following, the one having the highest redox potential is? a. Ubiquinone b. O
c. FMN d. NAD ATP synthase - Answers-9. ATP synthesis by chemiosmosis by? a. ATP dehydrogenase b. Gyrase c. ATP synthase d.Dehydrogenase Proton motive force - Answers-10. The measure of potential energy stored as combination of proton and voltage gradients across membrane is termed as? a. Proton motive force b. Electron motive force c. Molecule motive force d. Ion motive force Acyl cartinine - Answers-11. The transport of acyl co-A for oxidation using a shuttle involves formation of the intermediate a. Acyl coenzyme A b. 3 acetyl co-A c. Acyl cartinine d. None Mitochondrial matrix - Answers-12. The acyl co-A formed in the cytosol is transported to a. Mitochondrial matrix b. Microsomes c. ER d. Remains in cytosol Are required to make ATP - Answers-13. Membrane potential and proton gradient a. Cancel one another when uncouplers are present b. Reinforce one another when respiratory inhibitors are present c. Are sufficient, separately to make ATP from ADP + Pi d. Are required to make ATP Mitochondria - Answers-14. Where does oxidative phosphorylation take place? a. Ribosomes b. Nucleus c. Mitochondria d. Cell membrane 60% - Answers-15. What is the proportion of ATP produced by oxidative phosphorylation? a. 60% b. 70% c. 80%
d. 90% NADH and FADH2 - Answers-16. Products of glucose oxidation essential for oxidative phosphorylation are a. Pyruvate b. Acetyl co-A c. NADPH and ATP d. NADH and FADH Increase ATP production - Answers-17. The effect of increased levels of hydrogen ions in the inter-membrane space of the mitochondria is a. Increase ATP production b. Decreased levels of oxidative phosphorylation c. Increased levels of water in inter-membrane space d. Decreased levels of chemiosmosis a. NAD-linked dehydrogenases - Answers-1. In mitochondria, hydride ions are removed from substrates by? a. NAD-linked dehydrogenases b. NADP-linked dehydrogenases c. ATP synthase d. Succinate dehydrogenases 13 - Answers-2. How many human mitochondrial proteins are encoded in the mitochondrial genome and synthesized within mitochondria? a. 11 b. 12 c. 13 d. 14 a. Absence of genetic recombination of mt-DNA - Answers-3. Mitochondrial DNA is one of the best marker tools for population biologists and evolutionary biologists because a. Absence of genetic recombination of mt-DNA b. Mitochondrial genes are specific to mt-DNA c. It can be easily isolated d. It undergoes spontaneous mutation d. NADH and FADH2 - Answers-4. Products of glucose oxidation essential for oxidative phosphorylation are a. Pyruvate b. Acetyl CoA c. NADPH and ATP d. NADH and FADH Inner mitochondrial membrane - Answers-5. Enzymes catalyzing electron transport are present mainly in the
a. Ribosomes b. Endoplasmic reticulum c. Lysosomes d. Inner mitochondrial membrane NADP - Answers-6. Mitochondrial alpha-ketoglutarate dehydrogenase complex requires all the following to function except a. CoA b. FAD c. NAD d. NADP Mitochondria - Answers-7. Enzymes responsible for ketone body formation are associated mainly with the a. Mitochondria b. Endoplasmic reticulum c. Nucleus d. Golgi apparatus Malate - Answers-8. Mitochondrial membrane is freely permeable to a. Pyruvate b. Malate c. Oxaloacetate d. Fumarate d. Glucose 6-phosphate dehydrogenase - Answers-9. A deficiency in which enzyme of the pentose phosphate pathway leads to hemolytic anemia and favism? a. Lactonase b. Transaldolase c. Transketolase d. Glucose 6-phosphate dehydrogenase Ribulose and NADPH - Answers-10. In the pentose phosphate pathway, the major products are a. Ribulose and NADPH b. Ribulose and NADH c. Ribulose and NAD+ d. Ribulose and ATP c. The pathway supplies ribose 5-phosphate and NADPH in the quantities the cell requires - Answers-11. Which of the following statements is correct about oxidative pentose phosphate pathway? a. It generates NADH b. It oxidizes NADPH to NADP+ c. The pathway supplies ribose 5-phosphate and NADPH in the quantities the cell requires
d. Glucose 6-phosphatase catalyzes the rate limiting reaction of the pathway a. 3 molecules of pentose, 6 molecules of NADPH and 3 molecules of CO2 - Answers-
a. Glucose 6-phosphate dehydrogenase b. Aldolase c. Fructose 1,6-biphosphatase d. Phosphohexose isomerase Pentose phosphate pathway - Answers-19. The main source of reducing equivalents (NADPH) for lipogenesis is a. Pentose phosphate pathway b. Citric acid cycle c. Glycolysis d. Glycogenolysis d. Reduce oxidizing agents such as H2O2 - Answers-20. Reduced glutathione functions in red blood cells to a. Produce NADPH b. Reduce methemoglobin to hemoglobin c. Produce NADH d. Reduce oxidizing agents such as H2O2 Tripeptide - Answers-21. Glutathione is a a. Dipeptide b. Tripeptide c. Polypeptide d. None of the above Adenine - Answers-1. Identify the purine base of nucleic acids in the following: a. Cytosine b. Thymine c. Uracil d. Adenine c. The bases in nucleotides are attached to a pentose sugar moiety by a glycosidic linkage - Answers-2. Which of the following statements is true? a. Sugar component of a nucleotide is ribose b. Sugar component of a nucleotide is deoxyribose c. The bases in nucleotides are attached to a pentose sugar moiety by a glycosidic linkage d. The sugar molecule of the nucleotide is in L-configuration A base + a sugar - Answers-3. What is the composition of a nucleoside? a. A sugar + a phosphate b. A base + a sugar c. A base + a phosphate d. A base + a sugar + a phosphate A base + a sugar + a phosphate - Answers-4. What is the composition of a nucleotide?
a. A sugar + a phosphate b. A base + a sugar c. A base + a phosphate d. A base + a sugar + a phosphate Phosphodiester bond - Answers-5. Group of adjacent nucleotides are joined by? a. Phosphodiester bond b. Peptide bond c. Ionic bond d. Covalent bond a. 5' phosphate group of one nucleotide unit is joined to the 3' hydroxyl group to the next nucleotide - Answers-6. Which of the following is true about phosphodiester linkage? a. 5' phosphate group of one nucleotide unit is joined to the 3' hydroxyl group to the next nucleotide b. 3' phosphate group of one nucleotide unit is joined to the 5' hydroxyl group to the next nucleotide c. 5' phosphate group of one nucleotide unit is joined to the 5' hydroxyl group to the next nucleotide d. 3' phosphate group of one nucleotide unit is joined to the 3' hydroxyl group to the next nucleotide Adenylosuccinate - Answers-7. In the pathway of de novo synthesis of purine nucleotides, all of the following are allosteric enzymes except a. PRPP glutamyl amido transferase b. Adenylosuccinate synthetase c. IMP dehydrogenase d. Adenylosuccinate PRPP synthetase - Answers-8. All of the following enzymes are unique to purine nucleotide synthesis except a. PRPP synthetase b. PRPP glutamyl amido transferase c. Adenylosuccinate synthetase d. IMP dehydrogenase GMP and AMP - Answers-9. An allosteric inhibitor of PRPP glutamyl amido transferase is a. AMP b. ADP c. All of these d. GMP AND AMP PRPP glutamyl amido transferase - Answers-10. The first reaction unique to purine nucleotide synthesis is catalyzed by a. PRPP synthetase
b. PRPP glutamyl amido transferase c. Phosphoribosyl glycinamide synthetase d. Formyl transferase All of these - Answers-11. PRPP synthetase is allosterically inhibited by a. AMP b. ADP c. GMP d. All of these d. Adenylosuccinate synthetase - Answers-12. GMP is an allosteric inhibitor of all of the following except a. PRPP synthetase b. PRPP glutamyl amido synthetase c. IMP dehydrogenase d. Adenylosuccinate synthetase Both A and B - Answers-13. AMP is an allosteric inhibitor of a. PRPP synthetase b. Adenylosuccinate synthetase c. Both A and B d. None of these PRPP synthetase - Answers-14. An enzyme which acts as allosteric regulator and sensitive to both phosphate concentration and to the purine nucleotides is a. PRPP synthetase b. PRPP glutamyl amidotransferase c. HGPR Tase d. Formyl transferase c. Aspartate, glutamine and glycine - Answers-15. The nitrogen atoms for de novo synthesis of purine nucleotides are provided by a. Aspartate and glutamate b. Aspartate and glycine c. Aspartate, glutamine and glycine d. Aspartate, glutamate, and glycine d. One nitrogen and two carbon atoms - Answers-16. For de novo synthesis of purine nucleotides, glycine provides a. One nitrogen atom b. One nitrogen and one carbon atom c. Two carbon atoms d. One nitrogen and two carbon atoms Both - Answers-17. 5-phosphoribosyl- 1 - pyrophosphate is required for the synthesis of a. Purine nucleotides