CHT CHS CERTIFICATION - PRACTICE TEST QUESTIONS WITH 100% VERIFIED ANSWERS, Exams of Health sciences

Download CHT CHS CERTIFICATION - PRACTICE TEST QUESTIONS WITH 100% VERIFIED ANSWERS and more Exams Health sciences in PDF only on Docsity!

CHT CHS CERTIFICATION -

PRACTICE TEST QUESTIONS

WITH 100% VERIFIED

ANSWERS

Which of the following is not a secondary lymphoid organ? a. Spleen b. Thymus c. Lymph nodes d. Liver e. Tonsils b. Thymus Which of the following is not a component of the reticuloendothelial cell system? a. Microglial cells b. Kupffer cells c. Langerhans cells d. Neutrophils e. Monocytes d. Neutrophils Opsonization is a term to describe what? a. Lysis of bacteria b. Coating of bacteria

c. Ingestion of bacteria d. Killing of bacteria e. Phagocytosis b. Coating of bacteria Which of the following does not describe a role of antibodies in host defense? a. They serve as a bridge between bacteria and phagocytes b. They lyse bacteria c. They enhance complement binding to the bacterial cell wall d. They prevent viruses from infecting cells e. They bind pathogens in mucus secretions b. They lyse bacteria MHC Class I and II molecules differ in all of the following except a. Types of T cells they stimulate b. Types of cells they are expressed on c. Which chromosome they are located on d. Types of antigens they present e. Whether or not they have foreign peptides in the antigen-binding groove c. Which chromosome they are located on The primary role of the proteasome in antigen presentation is to a. Prevent premature folding of MHC class I molecules b. Process cytoplasmic proteins c. Degrade recycled MHC molecules d. Bind HLA-DM in the endosome e. Chaperone peptides to the cell surface b. Process cytoplasmic proteins

Peptides that bind to MHC class I molecules differ from peptides that bind to MHC class II molecules in all except which of the following ways? a. They are shorter b. They were processed by different proteases c. They anchor in the middle instead of the end of the MHC molecule d. They interact with different subsets of T cells c. They anchor in the middle instead of the end of the MHC molecule HLA-DM is primarily involved in the a. Activation of cytotoxic T cells b. Loading antigen onto HLA-DR molecules c. Preventing HLA-A molecules from folding prior to antigen binding d. Rejection of islet grafts e. Induction of diabetes mellitus b. Loading antigen onto HLA-DR molecules The antigen-binding site of an antibody is comprised of which of the following? a. The variable region of the light and heavy chains b. The variable region of the light chain only c. The entire light chain d. The entire heavy chain e. The Fc portion of the immunoglobulin molecule a. The variable region of the light and heavy chains The immunoglobulin that binds the most complement is a. IgA b. IgD c. IgM

d. IgG e. IgE c. IgM The immunoglobulin responsible for activating mast cells in an allergic response is a. IgA b. IgD c. IgM d. IgG e. IgE e. IgE The molecular interaction between an antibody and its corresponding antigen is mediated by all except which of the following? a. Hydrogen bonds b. Hydrophobic interactions c. Covalent bonds d. Electrostatic interactions e. Van der Waals interactions. c. Covalent bonds The phenomenon of 'affinity maturation,' in which later antibodies bind to antigen with a higher affinity than the ones made weeks earlier, is due to a. Allelic exclusion b. VDJ recombination c. Isotype switching d. Junctional flexibility e. Somatic hypermutation e. Somatic hypermutation

Positive and negative selection of T cells occurs... a. Before TCR gene rearrangement b. After TCR gene rearrangement c. After T cells have left the thymus d. In the bone marrow e. In the spleen b. After TCR gene rearrangement Antibodies in the serum of a transplant recipient that react with HLA class I (HLA-A,B,C) antigens on the donor are particular dangerous in that they can induce... a. Hyperacute rejection b. Acute rejection c. Chronic rejection d. Type III hypersensitivity reactions e. Type I anaphylactic reactions a. Hyperacute rejection Which of the following immunosuppressive drugs could be classified as an antiproliferative (anti- metabolite)? a. Cyclosporine b. FK c. Rapamycin d. Azathioprine e. Prednisolone (steroids) d. Azathioprine, induce T cell apoptosis Recipients of organ transplants are generally required to take immunosuppressive drugs for ... a. 6 months b. 2-5 years

c. 10-15 years d. Until there is no evidence of rejection e. For the remainder of their lives e. For the remainder of their lives If HLA-A, HLA-B and HLA-DR alleles are compared between a parent and a child, how many would you typically expect to be matched? a. Impossible to predict without DNA testing b. None c. 3 d. 4 e. 6 c. 3 IgM differs from IgG in all of the following except... a. Complement binding b. Avidity c. Molecular weight d. Affinity e. Kappa and lambda chains e. Kappa and lambda chains Dead cells stained with AO/EB appear orange because a. Ethidium bromide prevents AO binding b. AO leaks out of the dead cell, leaving only ethidium bromide c. Ethidium bromide fluoresces much more strongly than AO d. AO binds only RNA, which washes away when the cell is dead e. Dead cells are actually orange.

c. Ethidium bromide fluoresces much more strongly than AO. AO penetrate normal and early apoptotic cells with intact membranes, fluorescing green when bound to DNA. EB only entere cells with damaged membranes, such as late apoptotic and dead cells, emitting orange-red fluorescence when bound to concentrated DNA fragments or apoptotic bodies A patient with an anti-HLA-A2 antibody would likely have a PRA of? a. 10% b. 20% c. 30% d. 40% e. Cannot tell without knowing the composition of the panel e. Cannot tell without knowing the composition of the panel A patient with an anti-HLA-A2 antibody would be most likely to have a positive T cell crossmatch with which of the following donors? a. A1, A3, B8, B35, DR4, DR b. A1, A24, B7, B8, DR1, DR c. A24, A68, B7, B64, DR1, DR d. A11, A29, B38, B62, DR4, DR e. A1, A3, B35, B55, DR1, DR c. A24, A68, B7, B64, DR1, DR A patient with an anti-HLA-Bw4 antibody would be most likely to have a positive T cell crossmatch with which of the following donors? a. A1, A3, B8, B35, DR4, DR b. A1, A24, B7, B8, DR1, DR c. A24, A68, B7, B64, DR1, DR d. A11, A29, B38, B62, DR4, DR 7 e. A1, A3, B35, B55, DR1, DR d. A11, A29, B38, B62, DR4, DR

A patient with an anti-HLA-B8 CREG antibody might be expected to have a positive T cell crossmatches with all of the following donors except? a. A1, A3, B8, B35, DR4, DR b. A1, A24, B7, B8, DR1, DR c. A24, A68, B7, B64, DR1, DR d. A11, A29, B38, B62, DR4, DR e. A1, A3, B35, B55, DR1, DR e. A1, A3, B35, B55, DR1, DR A positive AHG T cell crossmatch between an untransfused male recipient and non-beaded spleen cells from the donor is most likely due to a. Anti-Bw b. Macrophage contamination c. Auto antibodies d. CYNAP antibodies e. Anti-HLA-DQ antibodies b. Macrophage contamination A positive B cell crossmatch does not usually lead to hyperacute renal allograft rejection because a. There are very few B cells in the transplanted kidney b. These antibodies are of low affinity c. These antibodies are of low avidity d. The vascular endothelium expresses very little HLA class II antigens e. The antibodies are usually in low titer d. The vascular endothelium expresses very little HLA class II antigens Among the HLA-Class II molecules a. Most polymorphism exists in exon 1 of the B chain

b. Most polymorphism exists in exon 2 of the A chain c. DRB3, DRB4 and DRB5 are the most polymorphic d. The DRA chain can combine with several different DRB chains e. Only the B chain makes up the peptide binding site d. The DRA chain can combine with several different DRB chains If the frequencies of alleles A and B are 0.2 and 0.6, respectively, what is the probability of an AA child in a mating of AB x AB parents? a. 0. b. 0. c. 0. d. 0. e. 0. c. 0. A positive MLC between a brother and sister who are both typed as HLA-DR4,- is most likely due to a. The siblings not being HLA-identical b. A meiotic crossover between HLA-DR4 alleles c. A proliferative response to HLA class I alleles d. High background in the MLC e. Somatic hypermutation a. The siblings not being HLA-identical Failure of bone marrow engraftment could be due to all of the following except... a. Insufficient preparative chemotherapy to the patient b. A positive crossmatch c. A graft that has too few CD34+ cells d. ABO-mismatched donor cells e. Not treating the patient with GM-CSF

d. ABO-mismatched donor cells The process of somatic hypermutation leads to ... a. Greater polymorphism of HLA class I b. Greater polymorphism of HLA class II c. Greater affinity of IgG molecules d. Inactivation of the T cell receptor e. Teenage mutant Ninja turtles c. Greater affinity of IgG molecules An immunosuppressive agent that binds to the same molecular target as CsA is a. OKT b. Prograft (FK506) c. CellCept (Mycophenolate) d. Imuran (azathioprine) e. Prednisone (steroids) b. Prograft (FK506) DR51, DR52 and DR53, respectively, are gene products of a DRA and a. DRB3, DRB4, DRB b. DRB1, DRB4, DRB c. DRB5, DRB4, DRB d. DRB1, DRB3, DRB e. DRB5, DRB3, DRB e. DRB5, DRB3, DRB

31. All of the following techniques are useful in distinguishing autoantibodies from high PRA alloantibodies except a. Platelet absorption

b. NIH-CDC analysis on frozen cell trays c. DTT treatment d. Flow cytometry e. Autocrossmatch b. NIH-CDC analysis on frozen cell trays The number of MHC-Class I and II loci... a. Is the same for all humans b. Has been constant throughout evolutionary history c. Is relatively constant, but many new alleles arise by translocation every year d. Varies with the haplotype e. Is the same for all primates d. Varies with the haplotype The T cell receptor delivers an intracellular activation signal primarily via which accessory molecule? a. CD b. CD c. CD d. CD e. CD a. CD The T cell receptor detects an MHC Class I molecule with the help of which accessory molecule? a. CD b. CD c. CD d. CD e. CD d. CD

Acute rejection is thought to be mediated primarily by ... a. T cells b. B cells c. Platelets d. Antibodies e. Cytokines a. T cells The T cell receptor detects an MHC Class II molecule with the help of which accessory molecule? a. CD b. CD c. CD d. CD e. CD c. CD The phenomenon by which a patient's IgM alloantibodies become IgG alloantibodies several weeks later is known as... a. Somatic hypermutation b. Affinity maturation c. Isotype switching d. Clonal selection e. Immunization c. Isotype switching A PRA specificity of B40, B44, B45 and B49 is most likely due to a. B7 CREG antibody b. B8 CREG antibody c. B12 CREG antibody

d. Multiple specific antibodies e. Isotope clustering c. B12 CREG antibody The T cell receptor differs from the IgM B cell receptor in that it... a. Is not secreted b. Does not undergo gene rearrangement c. Is a homodimer d. Is associated with accessory molecules to deliver intracellular signals e. Provides no useful role in effector function a. Is not secreted The cytokine that plays a critical role in the up-regulation of HLA-DR molecules is a. IL- 1 b. IL- 2 c. IFN-y d. IFN-β e. GM-CSF c. IFN-y A short DNA oligonucleotide used for PCR-SSP amplification is properly termed a a) Probe b) Amplicon c) Polymerase d) Primer e) Okazaki fragment d) Primer SSP and SSOP methods assay certain portions of HLA alleles. The critical portions assayed are

a) Introns b) Hypervariable regions c) Conserved regions d) Promoter regions e) GC-rich regions b) Hypervariable regions Molecular typing can be performed from cDNA molecules. cDNA molecules lack what feature which may require adaptation of methodology from genomic typing? a) Base methylation b) Stem/Loop structures c) Introns d) Hypervariable regions e) Exons c) Introns The wipe (swipe) test assays for contamination of pre-PCR regions with... a) Amplified DNA b) Degraded DNA c) Taq inhibitors d) HLA proteins a) Amplified DNA Which of the following pairs are unambiguously amino acid identical? a) DR17/DRB1* b) DRB401030101/DRB401030102N c) DRB10301/DRB d) DR3/DR e) DRB1030101/DRB e) DRB1030101/DRB1 030102

Which of the following represents invalid molecular nomenclature? a) DRB401030102N b) DQB1 c) Cw* d) A2* e) DQA1* d) A2* Which of the following statements is false? a) Class II proteins have polymorphism in only one of the two polypeptide chains b) Class I proteins have polymorphism in only one of the two polypeptide chains c) Class III proteins are on chromosome 6 d) beta2-microglobulin subtyping is not critical for bone marrow transplantation e) DRB4 alleles are not always present a) Class II proteins have polymorphism in only one of the two polypeptide chains A cord blood is typed to have more than 2 HLA-A and more than 2 HLA-DRB1 alleles. What is the least likely single explanation? a) Maternal blood present in cord blood sample b) Contamination of pre-PCR area with PCR amplicons c) Low temperature in high stringency wash d) New allele(s) detected e) DNA mixed with another sample d) New allele(s) detected A sample with a new HLA-B allele arrives in the laboratory. It has a point mutation in a region of exon 3 that had previously been considered monomorphic. What technique would be most likely to detect the new allele? a) PCR-SSP

b) PCR-SSOP c) SBT d) RFLP e) Anomalous linkage disequilibrium with HLA-Cw c) SBT A bone marrow patient is A1,A11,B62,B64,DRB10103,DRB1150101. Which of the following potential donors is the best match? a) A1,Blank,B62,B64,DRB10103,DRB b) A1,A11,B7,B8,DR5,DR c) A1,A11,B1401,B15,DRB10103,DRB d) A1,A9,B14,B15,DR1,DR e) A1,A11,B14,B15,DRB10102,DRB c) A1,A11,B1401,B15,DRB10103,DRB1 1501 Which of the listed probes will have the highest Tm? a) AACTAGTTA b) CTATGGATCGTTGGCTACTCT c) GTAGATTATATTACTCTAGCA d) AACTAGTTC e) ATATATATAT b) CTATGGATCGTTGGCTACTCT Primers and probes bind to their DNA targets through a process known as a) High stringency b) Hydrogen bonding c) Covalent bonding d) Primer dimerism e) Low Stringency

b) Hydrogen bonding Which is true of the 3' and/or 5' ends of an oligonucleotide primer? a) The 3' and 5' ends always have purines b) The 3' and 5' ends always have pyrimidines c) The 3' and 5' ends may both serve as an template for Taq elongation d) The 3' end may accept GTP in the presence of a DNA polymerase e) The 5' end is the critical portion for determining the specificity of a primer d) The 3' end may accept GTP in the presence of a DNA polymerase Which of the following is true regarding the DNA polymerase used in PCR? a) The enzyme should only accept nucleotide diphosphates b) The enzyme should have low fidelity c) The enzyme should denature at 37oC d) Isomerase enzymes should be able to switch strands e) The enzyme should not be heat labile e) The enzyme should not be heat labile Which of the following activities should be performed post-PCR? a) Amplification, probing, high stringency wash b) DNA extraction, low stringency wash, probing c) Gel electrophoresis, probing, primer aliquotting d) Amplification, probing, primer aliquotting e) DNA extraction, high stringency wash, primer synthesis a) Amplification, probing, high stringency wash Which statement best explains the "N" suffix sometimes seen with DNA HLA allele nomenclature? a) Some alleles are not typeable by molecular methods b) Some alleles are not typeable by serological methods

c) Serology and DNA sometimes arrive at different typings d) Mutations may prevent an HLA allele from being expressed e) Suffixes in molecular nomenclature distinguish class II from Class III alleles d) Mutations may prevent an HLA allele from being expressed SSP primers usually target what? a) IgG Fc regions b) Hypervariable regions c) Unique intronic sequences d) Conserved regions e) Sequences in DRB1 exon 1 b) Hypervariable regions High resolution Class I and Class II typing is most important in which of the following situations? a) Living-related kidney transplantation with high PRA b) ABO-mismatched liver transplant c) Unrelated bone marrow transplantation d) Autologous bone marrow transplantation e) Two haplotype matched living related bone marrow transplantation c) Unrelated bone marrow transplantation Which of the following is an ASHI requirement for PCR amplification setup? a) Dedicated pipetters b) Different color lab coats for pre- and post-PCR c) Phenol/chloroform DNA extraction d) Two independent interpretations of raw data e) Wipe test performed alongside every amplification setup a) Dedicated pipetters

Which of the following is the preferred sample for DNA extraction? a) Whole blood without anticoagulants b) Red blood cells c) Heparinized serum d) The distal ends of hair e) Whole blood with ACD anticoagulant e) Whole blood with ACD anticoagulant Which is not a proper method for minimizing PCR contamination? a) Frequent cleaning of pre-PCR areas with 10% bleach b) Aliquotting reagents into single-use aliquots c) Combining pre-PCR and post-PCR into the smallest practical space d) UV irradiation of pre-PCR areas e) Use of aerosol barrier pipet tips on pre-PCR pipetters f) Use of dUTP in PCR and the enzyme UNG on samples c) Combining pre-PCR and post-PCR into the smallest practical space A sample typed by SSP in 1996 was determined to be DRB10101,DRB10401. When the same sample was retyped in 1998 by SSP the typing was DRB10101,DRB104(01,34). What is the best explanation of these results? a) New alleles sometimes have the same primer reactivity patterns as old alleles b) Long term DNA storage at - 80oC affects primer reactivity c) IUB codes require reinterpretation with time d) As new DQB1 alleles are discovered the DRB1 typings should be revised for unusual linkages e) DRB1*0434 was thought to be a rare allele in 1996 but by 1998 was appreciated as a common allele a) New alleles sometimes have the same primer reactivity patterns as old alleles An HLA laboratory's DNA typing report lists 0101,1101 as the final result. What is wrong with this report?

a) 0101,1101 is an impossible combination for any HLA locus b) It is wrong to report results for only one HLA locus c) The HLA locus was not defined d) 1101 should always be reported as 110101 e) 0101,1101 should be written as 0101/ c) The HLA locus was not defined ASHI has detailed and mandatory QC requirements for which of the following in a molecular typing laboratory? a) Water bath cycle speeds b) Thermal cycler block temperature measurements c) Electrophoresis current variations d) Taq polymerase pH dependency e) F-stop and exposure settings b) Thermal cycler block temperature measurements Which statement accurately describes the PCR process? a) PCR products are inhibitors of the polymerase chain reaction b) PCR requires a special kind of restriction enzyme c) PCR requires forward and reverse probes d) The MW of the amplified DNA is not diagnostic of PCR specificity e) PCR geometrically amplifies the target DNA e) PCR geometrically amplifies the target DNA Which acronym is incorrect? a) ASHI: American Society for Histocompatibility and Immunogenetics b) PCR: Polymerase Chain Reaction c) RFLP: Required Forward Linkage PCR d) SSP: Sequence Specific Primers e) SBT: Sequence-Based Typing

c) RFLP: Required Forward Linkage PCR Which of the listed DNA typing methods is improperly matched with a critical methodological step? a) SSP: Gel electrophoresis b) SSOP: High stringency wash c) Reverse SSO: High stringency wash d) SSOP: DNA/membrane crosslinking e) Reverse SSO: DNA/membrane crosslinking e) Reverse SSO: DNA/membrane crosslinking Which statement is true of agarose gel electrophoresis of PCR-SSP products? a) Short DNA fragments sequester in the gel matrix and move slower than large fragments b) On a molar basis, ethidium bromide staining makes small DNA fragments brighter than large DNA fragments c) Cannot resolve differences in molecular weight less than 100 base pairs d) DNA migrates toward the positive electrode e) Electrophoresis is best performed in a medium of pure water d) DNA migrates toward the positive electrode Which of the following is generally considered an absolute contraindication to kidney transplantation? a) A positive B cell crossmatch b) A positive AHG-augmented T cell crossmatch c) A positive NIH T cell crossmatch d) A2 blood group donor into an O recipient e) O blood group donor into an A recipient c) A positive NIH T cell crossmatch Which of the following diseases is strongly associated with a HLA Class I allele? a) Ankylosing spondylitis

b) Type I insulin-dependent diabetes mellitus c) Narcolepsy d) Rheumatoid arthritis e) Multiple sclerosis a) Ankylosing spondylitis The proper final concentration of DMSO for freezing lymphocytes is a) 5% b) 10% c) 15% d) 20% e) dependent upon the concentration of serum b) 10% The alternative complement pathway differs from the classical complement pathway by all of the following except it... a) Does not require antibodies to initiate b) Utilizes Mg2+ instead of Ca2+ in an early step c) Starts with complement component C3 rather than C1 d) Results in a different membrane-attack complex e) Requires other serum proteins to function properly d) Results in a different membrane-attack complex Multiplexing of PCR-SSP reactions involves a) Adding multiple DNA's to the same PCR-SSP reaction b) Amplifying the DNA with a two-stage PCR amplification profile c) Using multiple 5' and/or 3' primers in the same reaction d) Computer analysis of SSP reaction patterns to look for multiple valid results e) Keeping the HLA field complex enough to deter new applicants to the field

c) Using multiple 5' and/or 3' primers in the same reaction Indirect allo MHC recognition is... a) The recipient recognizes processed donor MHC on self MHC b) The recipient recognizes the donor's MHC-bearing cells as foreign c) Stimulation of the anti-donor response through cytokine release d) Recruitment of CD45RO memory T cells against donor e) The recipient recognizes Class II MHC on the donor after treatment with IFN- a) The recipient recognizes processed donor MHC on self MHC The structural components of a nucleotide are... a) A,C,G,T b) A,C,G,U c) Base, Sugar, Phosphate d) Base, Acid, Neutral e) Hydrogen bonds, Phosphate Backbone, Hydroxyl Groups c) Base, Sugar, Phosphate RNA and DNA differ in... a) Three-dimensional conformation b) Base usage c) Sugar d) B & C only e) A, B, & C e) A, B, & C The MHC peptide binding groove... a) Holds peptides through covalent bonds b) Is the same for Class I and Class II

c) Completely hides the bound peptide d) A,B, & C e) None of the above e) None of the above Codon 10, position 2 of a sequence equivalent to what nucleotide position (assume that numbering start at the same position)? a) 10 b) 20 c) 25 d) 29 e) 32 d) 29 A typical thermal cycler program for clinical HLA typing has a) 1 PCR cycle b) 5 PCR cycles c) 10 PCR cycles d) 30 PCR cycles e) 60 PCR cycles d) 30 PCR cycles A PCR reaction is setup against exon 2 of an HLA gene. A 5' primer binding to nucleotides 10-25 and a 3' primer binding to nucleotides 105-90 are used. Assuming a successful amplification what is the size of the PCR product? a) 105bp b) 96bp c) 65bp d) 66bp e) 25bp

b) 96bp Standard nucleic acid purine bases are a) C,U,T b) A,B,Cw c) DR,DQ,DP d) C,T e) A,G e) A,G

80. Features of DNA Include... a) Anti-parallel strands b) External bases and Internal phosphate backbone c) Nuclear location in cells d) A, B only e) A, C only e) A, C only Which of the following samples would be unacceptable for HLA phenotyping by serology? a. Blood collected in sodium heparin b. Blood collected in CPDA- 1 c. Blood collected in ACD solution A d. Blood collected in ACD solution B e. Blood collected in EDTA e. Blood collected in EDTA Which sample is the best for molecular testing for class II HLA antigens? a. 5ml Ficoll separated PBL's (1x105 cells/ml) in PBS b. 3ml EBV transformed B cells (1x105 cells/ml) in PBS