Download Biology Exam Questions: Cellular Respiration and Photosynthesis - Prof. Michael T. Muller and more Exams Biology in PDF only on Docsity!
BIOS 100 - Exam II - Fall, 2003 Name: ___________________________________ Michael Muller, Instructor 22 October, 2003 TA: ______________________________________
The exam consists of 50 multiple guess questions and six pages. Please bubble in your name, last name first. Please be sure you use the name with which you are registered here at U IC and not a nickname. If you only learn one thing from college, please learn that whenever you fill out one of these forms, you should use a #2 pencil. Pen just won't work. Really, it won't. Good luck!
Matching - use the choices below to answer questions 1 to 6. Be sure to choose the best answ er.
I. Glycolysis II. Conversion of Pyruvate to Acetyl CoA III. Krebs Cycle IV. Electron Transport Phophorylation (Chemiosmosis) V. Lactic Acid Fermentation VI. Alcohol Fermentation VII. Light-Dependent Reactions of Photosynthesis VIII. Light-Independent Reactions of Photosynthesis (Calvin Cycle)
- This/these processes produce ATP A. I, III B. I, III, IV C. I, III, IV, V, VI D. I, III, IV , VII E. None of the above
- This/these processes have a net consumption of ATP A. I B. V, VI C. I, V, VI D. VIII E. None of the above
- This/these processes produce NADH A. I, III B. I, II, III C. I, II, III, IV D. I, III, IV , VII E. None of the above
- This/these processes produce convert NADH to NAD+ A. I, II B. I, II, III, IV C. I, IV, V, VI D. VII E. None of the above
- This/these processes produce CO 2 : A. III B. II, III C. II, III, VI D. II, III, V, VI E. None of the above
- This/these processes produce NADPH A. I, III B. I, II, III C. I, II, III, IV D. VII E. None of the above
- In non-cyclic photorespiration, from where does PSII replenish its lost electron? A. CO 2 B. O 2 C. H 2 O D. PSI E. NADPH
- On a hot, sunny day, where would you expect the pH to be low est? A. Cytoplasm B. Thylakoid space C. Stroma D. The space between the outer and inner chloroplast membrane
- Where would you expect to find the highest concentration of PSII A. On the outer chloroplast membrane B. On the inner chloroplast membrane C. On the thylakoid membrane D. On the outer mitochondrial membrane E. On the inner mitochondrial membrane
- Plant cells have functional mitochondria A. True B. False
- Assume a thylakoid is somehow punctured so that the interior of the thylakiod is no longer separated from the stroma by an intact membrane. This damage will have the most direct effect on which process? A. flow of electrons from photosystem II to photosystem I B. the absorption of light energy by chlorophyll C. the reduction of NADP+ to NADPH D. the synthesis of ATP by ATPsynthase E. None of the above
- The reactions of the Calvin cycle require all of the following molecules, EXCEPT A. CO2 B. RuBP C. glucose D. NADPH E. ATP
- Which of the following produces ATP and NADPH? A. Glycolysis B. Krebs Cycle C. Calvin Cycle D. Cyclic photophosphorylation E. Non-cyclic photophosphorylation
- Which of the following statements about leaves is FALSE? A. Simple leaves have only one blade B. M ost of the light harvesting takes place in the palisade mesophyll C. The leaf cuticle secretes a waxy cuticle D. C4 plants usually possess Kranz Anatomy E. All of the above statements about leaves are TRUE
- In a C4 plant, what enzyme fixes CO 2 in the bundle sheath? A. PEP Carboxylase B. Rubisco C. Malate dehydrogenase D. ATPase E. None of the above
- Which of the following photosynthetic systems is most efficient in moist environments? A. C3 B. C4 C. CAM
- Which state would you expect to find the highest concentration of C4 plants? A. California B. Kansas C. Illinois D. New York
- An increase in atmospheric CO 2 should lead to increased agricultural yields A. True B. False
- Fats can use some of the cellular respiration reactions, by using beta oxidation to cut their fatty acids into two-carbon molecules, which are fed into respiration as: A. FADH 2 B. AcetylCoA C. Pyruvate D. Double CO 2
- The goal of the Hershey-Chase experiment was to: A. Illustrate bacterial transformation B. Determine whether protein or DNA w as the molecule of heredity C. Determine the structure of DNA D. Determine w hether DNA replication was conservative, semi-conservative, or dispersive E. None of the above
- In a DNA nucleotide, there is a phosphate group attached to the ______ carbon and a hydroxyl group (-OH) attached to the ______ carbon A. 5' 3' B. 3' 5' C. 1' 5' D. 5' 1' E. 1' 3'
- This enzyme is unable to function properly unless a primer is present. A. Topoisomerase B. Ligase C. DN A Polymerase III D. Telomerase E. Helicase
- On which end of a DN A molecule w ould you expect telomerase activity to be greatest? A. The 5' end B. The 3' end C. Both ends equally
- Which of the following questions about DNA and events associated with DNA is FALSE? A. DNA replication is semiconservative B. Topoisomerase is most active during the S phase of the cell cycle C. A newly replicated DNA molecule is actually composed of DNA and the many RNA primers that were left behind D. A leading strand is longer than a lagging strand E. All of the above statements are TRUE
Given the template strand below, answer questions 34 to 36
** 3' G T G C T A C G G C T A A T G T C C C A T T G G 5'
- Which of the strands below is the coding strand? A. 3' GTGCTACGGCTAATGTCCCATTGG 5' B. 3' GGTTACCCTG TAATCGG CATCGTG 5' C. 3' CCAATGG GACATTAGCCGTAGCAC 5' D. 3' CACGATGCCG ATTACAGGGTAACC 5' E. None of the above
- What is the third amino acid code for in the mRNA that is transcribed from this template strand? A. Alanine B. Glycine C. Isoleucine D. Histidine E. Proline
- If the T with the two ** above it was changed to an A, what would be the resulting change in the protein A. Leucine changes to Glutamine B. Aspartic Acid to Valine C. Isoleucine changes to Phenylalanine D. “Stop” changes to Phenylalanine E. No change in the protein
- Which of the following mutations usually has the least effect on the protein? A. Neutral B. Missense C. Nonsense D. Frameshift
- What is the anticodon of 5' CAU 3? A. 5' GUA 3' B. 3' GUA 5' C. 5' CAU 3' D. 3' CAU 5'
- What amino acid is attached to a tRNA with the following anticodon: 3' CAU 5' A. Histidine B. Tyrosine C. Methionine D. Valine E. None of the above
- Which of the following is not necessary for initiation of translation? A. A charged tRNA in the A site B. A charged tRNA in the P site C. A small ribosomal subunit D. A large ribosomal subunit E. All of the above are necessary for initiation of translation
- Which of the following statements about translation in eukaryotes is FALSE? A. rRNA acts as a catalyst and catalyzes the peptide bond formation and breaks the bond between polypeptide chain and tRNA in P site B. During translocation, the tRN A in the A site moves to the P site C. During translocation, the uncharged tRNA will be ejected from the E site D. The release factor causes the addition of a water molecule instead of an amino acid to the polypeptide chain. E. All of the above statements about translation in eukaryotes are TRUE
- You have several thousand operons in your genome A. True B. False
- Which of the following statements about the lac operon is FALSE? A. The repressor protein has an allosteric site B. If the concentration of lactose is low, one can expect the concentration of cAMP to also be low C. cAMP is necessary to allow RNA polymerase to easily bind to the promoter D. When the lac operon is turned on, all three genes ( lac Z, lac Y, and lac A) will be transcribed E. All of the above statements about the lac operon are TRUE.
- M ost of the genetic regulation in eukaryotes is seen at which level? A. Transcription Control B. Post-Transcription Control C. Translation Control D. Post-Translation Control E. None of the above
- The basal promoter in most eukaryote genes contains the following: A. TFIID B. TATA box C. CAAT box D. RNA pol II E. None of the above
- Which of the following statements about a protein with a leucine zipper is TRUE? A. The protein is unstable in water B. The protein is a DN A binding protein C. The protein is an enzyme D. The protein is an enhanser E. None of the above
- Prokaryote DNA synthesis has many replication bubbles A. True B. False