Study with the several resources on Docsity
Earn points by helping other students or get them with a premium plan
Prepare for your exams
Study with the several resources on Docsity
Earn points to download
Earn points by helping other students or get them with a premium plan
Community
Ask the community for help and clear up your study doubts
Discover the best universities in your country according to Docsity users
Free resources
Download our free guides on studying techniques, anxiety management strategies, and thesis advice from Docsity tutors
A wide range of topics related to molecular biology techniques, including dna extraction, pcr, gel electrophoresis, and plasmid manipulation. It provides detailed explanations and step-by-step instructions for various experimental procedures, as well as troubleshooting tips and best practices. Likely intended for students or researchers in the fields of biology, biotechnology, or molecular genetics, and could be useful as study notes, lecture materials, or reference material for experiments and laboratory work.
Typology: Exams
1 / 22
Identifying potential customers for the businesses' products or services is an activity associated with the ________ function - - CORRECT ANSWER- - sales and marketing Which one of the following statements is not true about cloud computing? - - CORRECT ANSWER- - It removes any concern about data and systems security for businesses. The three principal levels of hierarchies within a business organization are: - - CORRECT ANSWER- - senior management, middle management, and operational management. A firm can exercise greater control over its suppliers in terms of price, quality, and delivery schedules by having: - - CORRECT ANSWER- - more suppliers What service converts natural language names to IP addresses, so we don't have to remember strings of 12 numbers? - - CORRECT ANSWER- - DNS The domain .gov is a(n): - - CORRECT ANSWER- - top level domain Activities like training employees or maintaining technology services are represented as ________ in the value chain. - - CORRECT ANSWER- - support activities If a group of business analysts wants to determine how other companies might influence their own organization's ability to gain competitive advantage, then they would most likely use the _______________ model as an analysis tool. - - CORRECT ANSWER- - Porter's Five Forces
Kenzie's Ice Cream recently faced competition against their flagship brand of "soft serve ice cream." The competitor made significant in-roads into this market by offering three varieties of "soft serve ice cream." Kenzie's decided to counter this threat by introducing five new varieties of ice creams. Which competitive strategy is Kenzie's implementing? - - CORRECT ANSWER- - differentiation Glazer & Hicks is a firm that offers enterprise software solutions to independent retailers. The firm was recently awarded a contract from a major national retail chain to develop and implement proprietary software that tracks inventory, restocking, and supplier information. Which of the following actions will be most difficult to perform when implementing the new information system? - - CORRECT ANSWER- - Train the employees to break their years of old habits and to use/manage the new system. Synapz, a manufacturer of office automation products, recently received a patent (for their product) an advanced therapeutic ergonomics technology. By doing this which strategy is Synapz following? - - CORRECT ANSWER- - Creation of entry barriers. Which of the following is a component of an information system, but not of information technology? - - CORRECT ANSWER- - people You are the production manager at a cola manufacturer's bottling plant. You receive a daily report that contains the list of raw materials stored in the warehouse. You find that the list includes items that are not present in the warehouse. The list that you received would qualify as bad information because it is ________. - - CORRECT ANSWER- - inaccurate A retail marketing company sells such products as agricultural produce and consumer products. The company acquires materials from farmers and local producers. This process of obtaining the inputs needed for a business is called ________. - - CORRECT ANSWER- - inbound logistics
Software as a Service (SaaS) is an example of which of the following? - - CORRECT ANSWER- - cloud computing Wake Sports Inc. is a sports equipment provider that markets its products through a chain of retail outlets in three states. As part of its expansion strategy, the company decides to open outlets in six more states and decides to revise its existing business processes. According to the five-component model of information systems, which of the following processes will be the least disruptive to the organization? - - CORRECT ANSWER- - buying new computers to place within their stores The difference between the value a customer is willing to pay and the cost of the activity is called the ________. - - CORRECT ANSWER- - margin The components of IT Infrastructure include all of the following except: - - CORRECT ANSWER- - business processes Which one of the following is not an essential characteristic of cloud computing? - - CORRECT ANSWER- - open source software Which one of the following industries has the lowest barrier to entry? - - CORRECT ANSWER- - small retailer The support activities of a firm include: - - CORRECT ANSWER- - Administrative and management, human resources, technology, and procurement. An order management information system creates an order number for each order; which of the five system components is represented by the order number? - - CORRECT ANSWER-
Which of the following is an example of raw data from an automobile manufacturer? - - CORRECT ANSWER- - One Subaru Outback sold January 7, 2019 in Mount Kisco, New York for $25,000. Your wireless home router is an example of the ________ component of an information system. - - CORRECT ANSWER- - hardware A firm that must invest in a new information system in order to comply with federal legislation is investing to achieve which of the following business objectives? - - CORRECT ANSWER- - survival Complete the equation: ___ = Hardware + Software + Data - - CORRECT ANSWER- - Information technology (IT) ____ is the means of transforming raw data into a more useful format. - - CORRECT ANSWER- - processing The median home price in Winston-Salem for the month of January is an example of ____. -
Which one of the following statements is not a typical benefit of SaaS for a firm? - - CORRECT ANSWER- - SaaS provider provides yearly discounts on buying hardware systems. Which one of the following statements in not true about the Internet? - - CORRECT ANSWER- - The Web is another name for the Internet The ___ is considered the "brain" of the computer. - - CORRECT ANSWER- - CPU As a manager in your organization, you need to decide the most efficient means of implementing an electronic payroll software system within a very tight budget. Which one of the following would be the least costly method of implementing this new software? - - CORRECT ANSWER- - Leasing the software over the Internet The correct order of steps for "How computers work" is: - - CORRECT ANSWER- - Input, storage, processing, output Which one of the following statements is not true about Cloud Computing? - - CORRECT ANSWER- - There is one public cloud that all organizations share. ____ is an essential component of all devices from PCs to smart phones, as it gives applications a place to store and access data on a short-term basis. - - CORRECT ANSWER- - RAM If you use Google Sheets to create and save a document that you want to access later, you are storing the document in what type of cloud? - - CORRECT ANSWER- - public SaaS, PaaS, and IaaS are examples of a way to ______ services over the Internet. - - CORRECT ANSWER- - rent vs buy
_____ breaks large data into smaller packets and ensures that the data is intact once it is reassembled at its destination. - - CORRECT ANSWER- - Transmission Control Protocol (TCP) In order to create a computer network, you need at least ____ computers. - - CORRECT ANSWER- - 2 A manufacturer of deep-sea oil rigs may be least concerned about this marketplace force, according to Porter's Five Forces Model. - - CORRECT ANSWER- - new market entrants The method of slicing digital messages into parcels, transmitting them along different communication paths, and reassembling them at their destinations is called - - CORRECT ANSWER- - packet switching In the value chain model, ______ activities are most directly related to the production and distribution of the firm's products and services that create value for the customer. - - CORRECT ANSWER- - primary A(n) ________ is a set of logically related activities, or collection of routines, for accomplishing a specific business result. - - CORRECT ANSWER- - business processes Which of the following is an example of a cross-functional business process? - - CORRECT ANSWER- - ??? ____ is a system or process that provides the information necessary to manage an organization in an efficient and effective manner and to aid in the process of decision- making. - - CORRECT ANSWER- - MIS
Graduate school recruiters have found that students who earned an "A" in a Management Information Systems course tend to perform in the top of their class in a graduate-level Data Analytics program. This is an example of _______. - - CORRECT ANSWER- - knowledge _____ is a collection of instructions that enable the user to interact with a computer, its hardware, or perform tasks--without which most computers would be useless. - - CORRECT ANSWER- - software According to the case study article, "Look to the Cloud," which company decided to move most of its data and computing systems from AWS and build its own systems that were better suited to its needs? - - CORRECT ANSWER- - ??? _____________ is a combination of massive quantities of structured, semi-structured, and unstructured data collected by organizations (internally and externally) that can be mined (data mining) for information and used in machine learning projects, predictive analytic modeling, and other advanced analytics applications. - - CORRECT ANSWER- - Big data If you can follow a definite procedure to make a business decision, you are making a(n) ________ decision. - - CORRECT ANSWER- - structured The Knowledge Management Value Chain is composed of 4 stages, where each stage adds value to raw data. Which one of the following depicts the 4 stages in the correct order as information is transformed into usable knowledge? - - CORRECT ANSWER- - Acquisition, Storage, Dissemination, Application A benefit of a ________ is that users can obtain a consolidated view of organizational data, because the data is located in one place. - - CORRECT ANSWER- - data warehouse As a brand manager for an energy drink company, you must decide between two new flavors of the beverage to put into production. This is an example of a(n) _____ decision. - - CORRECT ANSWER- - unstructured
Duplicate data in multiple data files is called data ________. - - CORRECT ANSWER- - redundancy As a new member of the management training program at Amazon, you receive a booklet from Human Resources. This booklet contains documents which detail many of the procedures and policies of the company. This booklet is an example of _____. - - CORRECT ANSWER- - explicit knowledge As special software to create and maintain a database, what does DBMS stands for _________. - - CORRECT ANSWER- - Database management system For a taxi company, ____ knowledge might include the experience of drivers, such as the best alternate routes between destinations or passenger needs. - - CORRECT ANSWER- - tacit You have been provided with a data file from the sales department of your company. You must determine how accurate, clean, complete and reasonably free of errors the data is in the file. In other words, you must determine the data ____ of the data in that file. - - CORRECT ANSWER- - quality A network of organizations and business processes for procuring raw materials, transforming these materials into intermediate and finished products, and distributing the finished products to customers is called a - - CORRECT ANSWER- - supply chain A limitation of data warehouses is that in some companies there may be the problem that employees do not want to ______ their data with other departments. - - CORRECT ANSWER-
_____ is a subset of business analytics and refers to exploring an existing large dataset to unearth previously unknown patterns, relationships and anomalies that are present in the data. - - CORRECT ANSWER- - data mining The quality of ubiquity, as it relates to e-commerce, is illustrated by? - - CORRECT ANSWER- - the availability of the Internet everywhere, at anytime Department managers for the City of Winston-Salem are required to submit their revised departmental budget for the following fiscal year by March 30 each year. This is an example of a(n) ________ decision. - - CORRECT ANSWER- - semi-structured In discussing the storage of large amounts of data in a computer system, which one of the following represents the largest unit of measurement? - - CORRECT ANSWER- - exabyte Intranet portals, search engines, and collaboration tools are used to ______ knowledge in an organization. - - CORRECT ANSWER- - disseminate Customer relationship management applications dealing with the analysis of customer data to provide information for improving business performance best describes ________ applications. - - CORRECT ANSWER- - analytical CRM Which of the following is not one of the six Vs of Big Data? - - CORRECT ANSWER- - vision The act of engaging consumers in a dialog that dynamically adjusts the experience to the individual describes which dimension of e-commerce technology? - - CORRECT ANSWER-
You are creating a database to store Wake Forest University student information. Which one of the following fields is the most likely candidate to use as the basis for a primary key in the Student database? - - CORRECT ANSWER- - student WFU ID number A(n) ________ view shows data as it is actually organized and structured in the database. - - CORRECT ANSWER- - physical In a table for customers, the information about a single customer would reside in a single ___. - - CORRECT ANSWER- - row (tuple) During our discussion of B2B e-Commerce, we looked at https://business.amazon.com as an example of which type of B2B business model? - - CORRECT ANSWER- - net marketplace Which metric is based on the relationship between the revenue produced by a specific customer, the expenses incurred in acquiring and servicing that customer, and the expected life of the relationship between the customer and the company? - - CORRECT ANSWER- - customer lifetime value Craigslist is an example of ____. - - CORRECT ANSWER- - C2C e-commerce Information ________ exists when one party in a transaction has more information that is important for the transaction than the other party. - - CORRECT ANSWER- - asymmetry In a data table, a characteristic or quality describing an entity is called a(n) ____ - - CORRECT ANSWER- - attribute Compared to traditional markets, digital markets have: - - CORRECT ANSWER- - lower distributed delivery costs
Tracking the click-streams of individuals for the purpose of understanding their interests and exposing them to suitable advertisements is called? - - CORRECT ANSWER- - behavioral targeting Which of the following is the type of logical database model that treats data as if they were stored in two-dimensional tables? - - CORRECT ANSWER- - relational DBMS Your company provides online tax preparation software. Users can download forms and read tips online without paying, but a fee is charged for using the advanced tax form management services. This is an example of which type of revenue model? - - CORRECT ANSWER- - free/freemium Which of the following best illustrates the e-Commerce transaction fee revenue model? - - CORRECT ANSWER- - e-bay recieves a small fee if asellerissuccessful.in selling an item. One of the goals of an ERP system is to have which of the following? - - CORRECT ANSWER-
The removal of a business responsible for the go-between steps in a value chain is know as _______. An example of this is when hotels operate their own reservation web sites and eliminate the need to pay travel agents to book hotel rooms for customers. - - CORRECT ANSWER- - Disintermediation The circular plasmid shown was double-digested with HindIII and EcoRI. Which of the following represents the size (in bp) of a restriction fragment generated from this digestion?
In a semi log graph for graphing a gel, what goes on the x axis and y axis, respectively? - - CORRECT ANSWER- - Distance traveled, base pairs Could we have substituted human DNA polymerase for Taq polymerase when performing our PCR reaction? Why or why not? - - CORRECT ANSWER- - No, because we need a DNA polymerase that can function at a high temperature. Human DNA polymerase would be denatured, and thus rendered inactive, by the high temperatures used by the thermocycler. How many target (double stranded) sequences are produced after the 1st cycle of PCR? - - CORRECT ANSWER- - 0 DNA migrates towards which electrode? - - CORRECT ANSWER- - Positive anode Why would you not want to maintain your PCR reaction at 95 °C for no more than a few minutes? - - CORRECT ANSWER- - Even at 95 °C, thermophilic DNA polymerases will degrade under prolonged exposure What is NOT a purpose of the DNA Ladder? - - CORRECT ANSWER- - Used as a visual determinant for how long to run the gel, even without UV light Which is true of buffer P2? - - CORRECT ANSWER- - Uses NaOH to destabilize cell membranes On the following streak plate of a culture of bacteria: Which section is the least diluted? Which section is the most diluted section? - - CORRECT ANSWER- - 1 3
Before conducting an experiment or preparing a procedure, what must be done? - - CORRECT ANSWER- - Formulate a hypothesis What are the two main functions of loading dye? - - CORRECT ANSWER- - Loading dye helps to sink DNA into the wells, as well as it can be used as a visual determinant of how long to run your gel without visualizing it under UV light. What is the bleach:water dilution ratio in a 10% bleach solution? - - CORRECT ANSWER- - 1: What are the major safety hazards when running an agarose gel? - - CORRECT ANSWER- - Ethidium bromide and ultraviolet light. If you do everything correctly the primary product of plasmid extraction procedure would be: - - CORRECT ANSWER- - Supercoiled plasmid DNA. To increase the separation of the large sized bands in your DNA agarose gel, you want to: - - CORRECT ANSWER- - Decrease the % agarose. Given the following primer sequence, 5'- GGGCCATGCAGGAACGTGACCTTCCCGT - 3', what Tm would you expect? Tm = 4 (G + C) + 2 (A + T) °C - - CORRECT ANSWER- - 92 °C When designing PCR primers, hairpins: - - CORRECT ANSWER- - Will interfere with the PCR reaction. If the reverse primer is complimentary to itself, it can form: - - CORRECT ANSWER- - Primer dimers.
What is an issue with the following primer sequence? 5'- AAT TGC GCG ATG CGC GCG CGC
CTTGAG - - CORRECT ANSWER- - forward: 5' - TTACTGTAGAGCGTTGAGAATCTGC - 3' reverse: 5' - ATGTTCAAAACGACGCTCTGCGCCT - 3' Tm (forward) - 2 (6A + 8T) + 4 ( 7G + 4C) = 72 °C Tm (reverse) = 2 (6A + 6T) + 4 ( 5G + 8C) = 76 °C If the PCR forward and reverse primers are complimentary to each other, they will form: - - CORRECT ANSWER- - Heterodimers
You recently got a job as a doctor and received a patient who has a chronic cough and blood tinged sputum. You immediately think the patient may be positive for tuberculosis, but to be sure you decide to perform PCR on a sputum sample from the patient. What would be strong negative and positive control, as well as the experimental group for a PCR test for tuberculosis? - - CORRECT ANSWER- - No sample control/negative sputum control: Negative Positive sputum control/TB DNA: Positive Sputum from the patient: Experimental What is NOT a requirement for a strong hypothesis? - - CORRECT ANSWER- - It must be a true statement. How many dsDNA target strands are obtained after the 3rd cycle of PCR assuming you start with a single dsDNA template? - - CORRECT ANSWER- - 2 What is special about the DNA polymerase we use for PCR? - - CORRECT ANSWER- - It can withstand higher temperatures without denaturing. What are the benefits of loading dye used for running DNA during gel electrophoresis? A) It helps the researcher to follow the progress of the gel. B) It allows DNA to fluoresce under UV light. C) It helps the DNA sink into the wells. D) It imparts an even charge along the DNA, allowing it to travel based on size alone. - - CORRECT ANSWER- - A and C Which is not an example of why a plasmid would be maintained in a cell? - - CORRECT ANSWER- - Organism keeps extra DNA in the case that it could become beneficial when introduced to novel environments
Why might a low copy number plasmid be useful for certain cloning projects? - - CORRECT ANSWER- - High copy plasmids may produce too much of a toxic protein. What happens if you accidentally shear the chromosomal DNA after adding P2 and N3? - - CORRECT ANSWER- - The fragments of the chromosome could be small enough to reanneal and go back into solution, contaminating your plasmid prep. What is unique about restriction sites cut by restriction enzymes? - - CORRECT ANSWER- - They tend to be palindromic. What is 1.3 mL in μL? - - CORRECT ANSWER- - 1300 How does the plasmid DNA bind to the filter? - - CORRECT ANSWER- - Positive charges on the filter allow binding. A research assistant utilizes the Qiagen plasmid DNA isolation procedure to isolate pBR322 plasmid DNA. Her lab runs out of the normal silica-based columns provided in the kit, so she substitutes a different column. The alternative column she uses binds DNA most efficiently in the size range from 70-100 Kb, and filters out all DNA less than 10 Kb. What is the expected yield for the plasmid pBR322? - - CORRECT ANSWER- - No pBR322 DNA You accidentally add DNAse instead of RNAse to buffer P1. How will this affect your plasmid purification? - - CORRECT ANSWER- - DNA will be degraded You are interested in amplifying a specific region of DNA to determine if a bacterium of interest is present. You set up and run a PCR reaction when viewing your results you see no band in your no-template control lane, but you see multiple bands in both your positive control and your experimental group. What went wrong? - - CORRECT ANSWER- - Non- specific binding of primers
What would you do to fix the problem you encountered in the question above? - - CORRECT ANSWER- - Raise the annealing temperature Imagine that while performing our Qiagen DNA extraction procedure, you forgot to add the EB solution. This could result in which of the following? - - CORRECT ANSWER- - The plasmid DNA would fail to elute from the silica. After you run your samples in your gel, you move it to the UV light only to find that no bands appear on your gel. Which of the following may have caused this? - - CORRECT ANSWER- - The positive and negative electrodes were reversed In order to centrifuge a tube containing 200 microliters of blue dye, it is necessary to: - - CORRECT ANSWER- - Fill a separate tube with 200 microliters of water and position the tubes directly opposite each other in the centrifuge. At 72°C, taq DNA polymerase will: - - CORRECT ANSWER- - Elongate the DNA sequence starting from the 3' end of the primer. The primer is elongated in which direction? - - CORRECT ANSWER- - 5' to 3' To increase the separation of the small sized bands in your DNA agarose gel, you want to: -
Extension allows the polymerase to amplify the target DNA. You made a mistake, when you were setting the PCR cycle, you typed in 65°C instead of 95°C for the initial step of your PCR program. (Assume all other steps were set up correctly.) How would this adversely affect your reaction? What overall result would you get after your PCR cycle has run to completion? - - CORRECT ANSWER- - DNA double strands cannot be separated, so no replication can be achieved. You will get no PCR products. Cells capable of uptake of DNA are termed_______. - - CORRECT ANSWER- - Competent cells You have two choices of DNA loading dye. 1: bromophenol blue or 2: xylene cyanol FF. In TBE buffer, bromophenol blue runs at the same speed as a 370bp DNA fragment while xylene cyanol FF runs at the same speed as a 4160 bp DNA fragment. You have a PCR product which you expect to be 1000bp. Which loading dye would you use to add to your sample and run on the gel? Explain your answer. - - CORRECT ANSWER- - Choose Bromophenol blue because you want to make ensure that the DNA fragment of interest remains in the gel. What is the purpose of adding ethidium bromide to the agarose gel? - - CORRECT ANSWER-
Use the vector map to propose 2 tests to verify that the plasmid you have been given is actually pUNK. - - CORRECT ANSWER- - A) RE digest, gel electrophoresis, check band sizes against vector map (check student answers to match map) B) antibiotic grow selection C) PCR If you ran a digest of pUNK (see previous question) using REs ScaI and BamHI, what would be the sizes of the resulting fragments? Identify the fragment that will migrate the furthest. -
Filter bottle: Cell culture media which can not be autoclaved. A student forgets to add loading dye to his plasmid DNA samples prior to pipetting the samples into the wells of an agarose gel. Realizing his mistake, the student then adds the loading dye (without any DNA) directly to the same wells. Upon visualizing the gel under UV light, the student will likely see: - - CORRECT ANSWER- - No distinct DNA bands, since the DNA probably would not have remained in the wells upon loading. Is it possible to correctly estimate the size of an undigested circular plasmid using the regular standard ladders we use in lab? Please explain your response. - - CORRECT ANSWER- - No this is not possible. The standard ladders we use in class are for estimating linear DNA fragments. It would not be accurate to estimate the size of a circular fragment from a linear DNA standard.