Docsity
Docsity

Prepare for your exams
Prepare for your exams

Study with the several resources on Docsity


Earn points to download
Earn points to download

Earn points by helping other students or get them with a premium plan


Guidelines and tips
Guidelines and tips

Fundamentals of Molecular Biology Techniques, Exams of Business Systems

A wide range of topics related to molecular biology techniques, including dna extraction, pcr, gel electrophoresis, and plasmid manipulation. It provides detailed explanations and step-by-step instructions for various experimental procedures, as well as troubleshooting tips and best practices. Likely intended for students or researchers in the fields of biology, biotechnology, or molecular genetics, and could be useful as study notes, lecture materials, or reference material for experiments and laboratory work.

Typology: Exams

2024/2025

Available from 10/09/2024

premium-essay
premium-essay 🇺🇸

5

(2)

1.1K documents

Partial preview of the text

Download Fundamentals of Molecular Biology Techniques and more Exams Business Systems in PDF only on Docsity!

MCB 251 - Final Exam Verified for Academic

Excellence Comprehensive Solutions for Every

Question With Detailed Explanations and Answers

Questions from World-Class Academics

Identifying potential customers for the businesses' products or services is an activity associated with the ________ function - - CORRECT ANSWER- - sales and marketing Which one of the following statements is not true about cloud computing? - - CORRECT ANSWER- - It removes any concern about data and systems security for businesses. The three principal levels of hierarchies within a business organization are: - - CORRECT ANSWER- - senior management, middle management, and operational management. A firm can exercise greater control over its suppliers in terms of price, quality, and delivery schedules by having: - - CORRECT ANSWER- - more suppliers What service converts natural language names to IP addresses, so we don't have to remember strings of 12 numbers? - - CORRECT ANSWER- - DNS The domain .gov is a(n): - - CORRECT ANSWER- - top level domain Activities like training employees or maintaining technology services are represented as ________ in the value chain. - - CORRECT ANSWER- - support activities If a group of business analysts wants to determine how other companies might influence their own organization's ability to gain competitive advantage, then they would most likely use the _______________ model as an analysis tool. - - CORRECT ANSWER- - Porter's Five Forces

Kenzie's Ice Cream recently faced competition against their flagship brand of "soft serve ice cream." The competitor made significant in-roads into this market by offering three varieties of "soft serve ice cream." Kenzie's decided to counter this threat by introducing five new varieties of ice creams. Which competitive strategy is Kenzie's implementing? - - CORRECT ANSWER- - differentiation Glazer & Hicks is a firm that offers enterprise software solutions to independent retailers. The firm was recently awarded a contract from a major national retail chain to develop and implement proprietary software that tracks inventory, restocking, and supplier information. Which of the following actions will be most difficult to perform when implementing the new information system? - - CORRECT ANSWER- - Train the employees to break their years of old habits and to use/manage the new system. Synapz, a manufacturer of office automation products, recently received a patent (for their product) an advanced therapeutic ergonomics technology. By doing this which strategy is Synapz following? - - CORRECT ANSWER- - Creation of entry barriers. Which of the following is a component of an information system, but not of information technology? - - CORRECT ANSWER- - people You are the production manager at a cola manufacturer's bottling plant. You receive a daily report that contains the list of raw materials stored in the warehouse. You find that the list includes items that are not present in the warehouse. The list that you received would qualify as bad information because it is ________. - - CORRECT ANSWER- - inaccurate A retail marketing company sells such products as agricultural produce and consumer products. The company acquires materials from farmers and local producers. This process of obtaining the inputs needed for a business is called ________. - - CORRECT ANSWER- - inbound logistics

Software as a Service (SaaS) is an example of which of the following? - - CORRECT ANSWER- - cloud computing Wake Sports Inc. is a sports equipment provider that markets its products through a chain of retail outlets in three states. As part of its expansion strategy, the company decides to open outlets in six more states and decides to revise its existing business processes. According to the five-component model of information systems, which of the following processes will be the least disruptive to the organization? - - CORRECT ANSWER- - buying new computers to place within their stores The difference between the value a customer is willing to pay and the cost of the activity is called the ________. - - CORRECT ANSWER- - margin The components of IT Infrastructure include all of the following except: - - CORRECT ANSWER- - business processes Which one of the following is not an essential characteristic of cloud computing? - - CORRECT ANSWER- - open source software Which one of the following industries has the lowest barrier to entry? - - CORRECT ANSWER- - small retailer The support activities of a firm include: - - CORRECT ANSWER- - Administrative and management, human resources, technology, and procurement. An order management information system creates an order number for each order; which of the five system components is represented by the order number? - - CORRECT ANSWER-

  • data

Which of the following is an example of raw data from an automobile manufacturer? - - CORRECT ANSWER- - One Subaru Outback sold January 7, 2019 in Mount Kisco, New York for $25,000. Your wireless home router is an example of the ________ component of an information system. - - CORRECT ANSWER- - hardware A firm that must invest in a new information system in order to comply with federal legislation is investing to achieve which of the following business objectives? - - CORRECT ANSWER- - survival Complete the equation: ___ = Hardware + Software + Data - - CORRECT ANSWER- - Information technology (IT) ____ is the means of transforming raw data into a more useful format. - - CORRECT ANSWER- - processing The median home price in Winston-Salem for the month of January is an example of ____. -

  • CORRECT ANSWER- - information If you had to explain SaaS and its purpose to a business colleague, which one of the following statements is a correct definition? - - CORRECT ANSWER- - SaaS is a means of hosting and managing access to software applications delivered over the Internet to clients on a subscription basis or "as needed' basis. The ____ is software that communicates with the computer hardware and allows other programs to run. - - CORRECT ANSWER- - operating system

Which one of the following statements is not a typical benefit of SaaS for a firm? - - CORRECT ANSWER- - SaaS provider provides yearly discounts on buying hardware systems. Which one of the following statements in not true about the Internet? - - CORRECT ANSWER- - The Web is another name for the Internet The ___ is considered the "brain" of the computer. - - CORRECT ANSWER- - CPU As a manager in your organization, you need to decide the most efficient means of implementing an electronic payroll software system within a very tight budget. Which one of the following would be the least costly method of implementing this new software? - - CORRECT ANSWER- - Leasing the software over the Internet The correct order of steps for "How computers work" is: - - CORRECT ANSWER- - Input, storage, processing, output Which one of the following statements is not true about Cloud Computing? - - CORRECT ANSWER- - There is one public cloud that all organizations share. ____ is an essential component of all devices from PCs to smart phones, as it gives applications a place to store and access data on a short-term basis. - - CORRECT ANSWER- - RAM If you use Google Sheets to create and save a document that you want to access later, you are storing the document in what type of cloud? - - CORRECT ANSWER- - public SaaS, PaaS, and IaaS are examples of a way to ______ services over the Internet. - - CORRECT ANSWER- - rent vs buy

_____ breaks large data into smaller packets and ensures that the data is intact once it is reassembled at its destination. - - CORRECT ANSWER- - Transmission Control Protocol (TCP) In order to create a computer network, you need at least ____ computers. - - CORRECT ANSWER- - 2 A manufacturer of deep-sea oil rigs may be least concerned about this marketplace force, according to Porter's Five Forces Model. - - CORRECT ANSWER- - new market entrants The method of slicing digital messages into parcels, transmitting them along different communication paths, and reassembling them at their destinations is called - - CORRECT ANSWER- - packet switching In the value chain model, ______ activities are most directly related to the production and distribution of the firm's products and services that create value for the customer. - - CORRECT ANSWER- - primary A(n) ________ is a set of logically related activities, or collection of routines, for accomplishing a specific business result. - - CORRECT ANSWER- - business processes Which of the following is an example of a cross-functional business process? - - CORRECT ANSWER- - ??? ____ is a system or process that provides the information necessary to manage an organization in an efficient and effective manner and to aid in the process of decision- making. - - CORRECT ANSWER- - MIS

Graduate school recruiters have found that students who earned an "A" in a Management Information Systems course tend to perform in the top of their class in a graduate-level Data Analytics program. This is an example of _______. - - CORRECT ANSWER- - knowledge _____ is a collection of instructions that enable the user to interact with a computer, its hardware, or perform tasks--without which most computers would be useless. - - CORRECT ANSWER- - software According to the case study article, "Look to the Cloud," which company decided to move most of its data and computing systems from AWS and build its own systems that were better suited to its needs? - - CORRECT ANSWER- - ??? _____________ is a combination of massive quantities of structured, semi-structured, and unstructured data collected by organizations (internally and externally) that can be mined (data mining) for information and used in machine learning projects, predictive analytic modeling, and other advanced analytics applications. - - CORRECT ANSWER- - Big data If you can follow a definite procedure to make a business decision, you are making a(n) ________ decision. - - CORRECT ANSWER- - structured The Knowledge Management Value Chain is composed of 4 stages, where each stage adds value to raw data. Which one of the following depicts the 4 stages in the correct order as information is transformed into usable knowledge? - - CORRECT ANSWER- - Acquisition, Storage, Dissemination, Application A benefit of a ________ is that users can obtain a consolidated view of organizational data, because the data is located in one place. - - CORRECT ANSWER- - data warehouse As a brand manager for an energy drink company, you must decide between two new flavors of the beverage to put into production. This is an example of a(n) _____ decision. - - CORRECT ANSWER- - unstructured

Duplicate data in multiple data files is called data ________. - - CORRECT ANSWER- - redundancy As a new member of the management training program at Amazon, you receive a booklet from Human Resources. This booklet contains documents which detail many of the procedures and policies of the company. This booklet is an example of _____. - - CORRECT ANSWER- - explicit knowledge As special software to create and maintain a database, what does DBMS stands for _________. - - CORRECT ANSWER- - Database management system For a taxi company, ____ knowledge might include the experience of drivers, such as the best alternate routes between destinations or passenger needs. - - CORRECT ANSWER- - tacit You have been provided with a data file from the sales department of your company. You must determine how accurate, clean, complete and reasonably free of errors the data is in the file. In other words, you must determine the data ____ of the data in that file. - - CORRECT ANSWER- - quality A network of organizations and business processes for procuring raw materials, transforming these materials into intermediate and finished products, and distributing the finished products to customers is called a - - CORRECT ANSWER- - supply chain A limitation of data warehouses is that in some companies there may be the problem that employees do not want to ______ their data with other departments. - - CORRECT ANSWER-

  • share

_____ is a subset of business analytics and refers to exploring an existing large dataset to unearth previously unknown patterns, relationships and anomalies that are present in the data. - - CORRECT ANSWER- - data mining The quality of ubiquity, as it relates to e-commerce, is illustrated by? - - CORRECT ANSWER- - the availability of the Internet everywhere, at anytime Department managers for the City of Winston-Salem are required to submit their revised departmental budget for the following fiscal year by March 30 each year. This is an example of a(n) ________ decision. - - CORRECT ANSWER- - semi-structured In discussing the storage of large amounts of data in a computer system, which one of the following represents the largest unit of measurement? - - CORRECT ANSWER- - exabyte Intranet portals, search engines, and collaboration tools are used to ______ knowledge in an organization. - - CORRECT ANSWER- - disseminate Customer relationship management applications dealing with the analysis of customer data to provide information for improving business performance best describes ________ applications. - - CORRECT ANSWER- - analytical CRM Which of the following is not one of the six Vs of Big Data? - - CORRECT ANSWER- - vision The act of engaging consumers in a dialog that dynamically adjusts the experience to the individual describes which dimension of e-commerce technology? - - CORRECT ANSWER-

  • interactivity Which of the following is the correct data hierarchical order? (top to bottom) - - CORRECT ANSWER- - Database, file, record, field, byte, bit

You are creating a database to store Wake Forest University student information. Which one of the following fields is the most likely candidate to use as the basis for a primary key in the Student database? - - CORRECT ANSWER- - student WFU ID number A(n) ________ view shows data as it is actually organized and structured in the database. - - CORRECT ANSWER- - physical In a table for customers, the information about a single customer would reside in a single ___. - - CORRECT ANSWER- - row (tuple) During our discussion of B2B e-Commerce, we looked at https://business.amazon.com as an example of which type of B2B business model? - - CORRECT ANSWER- - net marketplace Which metric is based on the relationship between the revenue produced by a specific customer, the expenses incurred in acquiring and servicing that customer, and the expected life of the relationship between the customer and the company? - - CORRECT ANSWER- - customer lifetime value Craigslist is an example of ____. - - CORRECT ANSWER- - C2C e-commerce Information ________ exists when one party in a transaction has more information that is important for the transaction than the other party. - - CORRECT ANSWER- - asymmetry In a data table, a characteristic or quality describing an entity is called a(n) ____ - - CORRECT ANSWER- - attribute Compared to traditional markets, digital markets have: - - CORRECT ANSWER- - lower distributed delivery costs

Tracking the click-streams of individuals for the purpose of understanding their interests and exposing them to suitable advertisements is called? - - CORRECT ANSWER- - behavioral targeting Which of the following is the type of logical database model that treats data as if they were stored in two-dimensional tables? - - CORRECT ANSWER- - relational DBMS Your company provides online tax preparation software. Users can download forms and read tips online without paying, but a fee is charged for using the advanced tax form management services. This is an example of which type of revenue model? - - CORRECT ANSWER- - free/freemium Which of the following best illustrates the e-Commerce transaction fee revenue model? - - CORRECT ANSWER- - e-bay recieves a small fee if asellerissuccessful.in selling an item. One of the goals of an ERP system is to have which of the following? - - CORRECT ANSWER-

  • a single centralized database You are a store manager for Target and need to calculate the gross pay for your cashiers, who are paid by the hour. This type of decision is considered a _____ decision. - - CORRECT ANSWER- - structured One of the ways in which e-commerce improves market efficiency is by improving ________, so consumers can more effectively compare vendors and pay the lowest possible amount at the best terms, eventually leading to the removal of inefficient vendors. - - CORRECT ANSWER- - information density A major concern mentioned in the article, "AI Promises to make life easier. But it could also change what it means to be Human," is that ______. - - CORRECT ANSWER- - as people rely on AI, they lose the capacity to make choices, particularly judgements that have moral implications

The removal of a business responsible for the go-between steps in a value chain is know as _______. An example of this is when hotels operate their own reservation web sites and eliminate the need to pay travel agents to book hotel rooms for customers. - - CORRECT ANSWER- - Disintermediation The circular plasmid shown was double-digested with HindIII and EcoRI. Which of the following represents the size (in bp) of a restriction fragment generated from this digestion?

    • CORRECT ANSWER- - 1122 A student forgets to add ethidium bromide to his agarose gel, which contains several samples of digested and undigested plasmid DNA. Upon visualizing the gel under UV light, the student will likely see: - - CORRECT ANSWER- - No distinct DNA bands, since ethidium bromide is required to visualize DNA under UV light. Please explain how to obtain a pure culture. - - CORRECT ANSWER- - Isolate individual bacterial colonies from the medium using a streak plate. Pick a single colony from this streak plate and use it to create a second streak plate. If the colonies on this second streak plate appear uniform, then this plate is considered a pure culture. What is the importance of the recovery period after transformation? - - CORRECT ANSWER-
  • Must have these 2 important ideas:
  1. It allows cells time to recover after the harsh transformation procedure
  2. It allows time for appropriate gene expression. This will allow the cat gene to get expressed Select which micropippettor would be the best to use to dispense the following volumes? -
  • CORRECT ANSWER- - p1000: 250 μl p100: 85 μl p10: 7 μl

In a semi log graph for graphing a gel, what goes on the x axis and y axis, respectively? - - CORRECT ANSWER- - Distance traveled, base pairs Could we have substituted human DNA polymerase for Taq polymerase when performing our PCR reaction? Why or why not? - - CORRECT ANSWER- - No, because we need a DNA polymerase that can function at a high temperature. Human DNA polymerase would be denatured, and thus rendered inactive, by the high temperatures used by the thermocycler. How many target (double stranded) sequences are produced after the 1st cycle of PCR? - - CORRECT ANSWER- - 0 DNA migrates towards which electrode? - - CORRECT ANSWER- - Positive anode Why would you not want to maintain your PCR reaction at 95 °C for no more than a few minutes? - - CORRECT ANSWER- - Even at 95 °C, thermophilic DNA polymerases will degrade under prolonged exposure What is NOT a purpose of the DNA Ladder? - - CORRECT ANSWER- - Used as a visual determinant for how long to run the gel, even without UV light Which is true of buffer P2? - - CORRECT ANSWER- - Uses NaOH to destabilize cell membranes On the following streak plate of a culture of bacteria: Which section is the least diluted? Which section is the most diluted section? - - CORRECT ANSWER- - 1 3

Before conducting an experiment or preparing a procedure, what must be done? - - CORRECT ANSWER- - Formulate a hypothesis What are the two main functions of loading dye? - - CORRECT ANSWER- - Loading dye helps to sink DNA into the wells, as well as it can be used as a visual determinant of how long to run your gel without visualizing it under UV light. What is the bleach:water dilution ratio in a 10% bleach solution? - - CORRECT ANSWER- - 1: What are the major safety hazards when running an agarose gel? - - CORRECT ANSWER- - Ethidium bromide and ultraviolet light. If you do everything correctly the primary product of plasmid extraction procedure would be: - - CORRECT ANSWER- - Supercoiled plasmid DNA. To increase the separation of the large sized bands in your DNA agarose gel, you want to: - - CORRECT ANSWER- - Decrease the % agarose. Given the following primer sequence, 5'- GGGCCATGCAGGAACGTGACCTTCCCGT - 3', what Tm would you expect? Tm = 4 (G + C) + 2 (A + T) °C - - CORRECT ANSWER- - 92 °C When designing PCR primers, hairpins: - - CORRECT ANSWER- - Will interfere with the PCR reaction. If the reverse primer is complimentary to itself, it can form: - - CORRECT ANSWER- - Primer dimers.

What is an issue with the following primer sequence? 5'- AAT TGC GCG ATG CGC GCG CGC

  • 3' - - CORRECT ANSWER- - Can form primer dimers What is the Tm of the following reverse primer? 5'- AAA GCG GGA TGC TAA TGC CCC GCT - 3' - - CORRECT ANSWER- - 76 Your friend gives you a pUC-19 empty vector. Use the following vector map to propose 2 tests to verify that the plasmid you have been given is actually pUC-19. - - CORRECT ANSWER- - Description of selection (Amp), restriction digest using 1+ REs in vector map, PCR amplification of specific sequence. When performing a transformation reaction using pBlu, you decide to also add a negative control in which no vector was added to your competent cells before heat shock. When plating onto LA Amp, you realize that the negative control plate has 230 colonies. What is NOT a possible reason for this unexpected growth? - - CORRECT ANSWER- - You added too much antibiotic to the plate. After finishing your cloning project in which you insert GFP into pBLU, what would NOT be a way in which you could check if your clones were correct? - - CORRECT ANSWER- - Isolate the plasmid using a Qiagen kit and re-transform into another background strain. What is the ideal ligation ratio of vector to insert? - - CORRECT ANSWER- - 3 vector : 1 insert What are the key characteristics of a good primer set? - - CORRECT ANSWER- - No secondary structure, similar annealing temperature, 3' end is a G or a C, no primer dimers Using the following sequence, design forward and reverse primers to amplify the whole sequence. Do not worry about hairpins and primer dimers. Write the primers in 5'-3' form. What is the Tm for each primer?

5'-

TTACTGTAGAGCGTTGAGAATCTGCCAGGCGGCGGCGACTCTCGCTGGATTGGGATAGTTTTTGT

TAGCC

AGCATCACGATACCCAGCTCTTTTTCTGGAATAAACGCGACATAGCTACCAAATCCGCCGGTCG

CCCCCG

TTTTATGCACCCATGATGCTCGTACTGCAGGAGTTGGAGGCGTAATCGCTTTTACGGGGCGTGCT

GCCAG

TGCAATTTTATTGTCACTGCCGTTAACGATGATGTCAGGATTTACCGGCCAGTCCAGCATTTCCCA

GCCC

AGACCCTGATACATATCGCCGGTTTGCCAGTAGCGAGATTGTGCCAGTTGTATCCCTTGCTGAAG

TGTTT

TGTCGTTGATATCACGGGGATTCATATTGCTTCGTACCCAGCAGGCCATATCTTCAATGGTCGACT

TCAC

ACCATAAGTTTCAGCATCTAACGCCCCTGGCGAAACATGAACTGCCTTGCCTTCGCGATATCCC

CAGGCG

TAATTCTTTTCTTCTGCGGGCGGTACATTAATCCACGTATGGTTGAGTTTGAGTGGCTGGAAGACA

CGAG

TTTGCATCGCCTGCTCAAAACTCAAACCAGACGGCTTCACAGCCAGTGCGCCGAACAAACCG

ATACTGGA

GTTGGCATACAGACGTTGTGTTCCTGGAGCCCATGCAGGCTGCCAGTTTTGATAGAAGCGCAGC

AAGTCG

CTTGAG - - CORRECT ANSWER- - forward: 5' - TTACTGTAGAGCGTTGAGAATCTGC - 3' reverse: 5' - ATGTTCAAAACGACGCTCTGCGCCT - 3' Tm (forward) - 2 (6A + 8T) + 4 ( 7G + 4C) = 72 °C Tm (reverse) = 2 (6A + 6T) + 4 ( 5G + 8C) = 76 °C If the PCR forward and reverse primers are complimentary to each other, they will form: - - CORRECT ANSWER- - Heterodimers

You recently got a job as a doctor and received a patient who has a chronic cough and blood tinged sputum. You immediately think the patient may be positive for tuberculosis, but to be sure you decide to perform PCR on a sputum sample from the patient. What would be strong negative and positive control, as well as the experimental group for a PCR test for tuberculosis? - - CORRECT ANSWER- - No sample control/negative sputum control: Negative Positive sputum control/TB DNA: Positive Sputum from the patient: Experimental What is NOT a requirement for a strong hypothesis? - - CORRECT ANSWER- - It must be a true statement. How many dsDNA target strands are obtained after the 3rd cycle of PCR assuming you start with a single dsDNA template? - - CORRECT ANSWER- - 2 What is special about the DNA polymerase we use for PCR? - - CORRECT ANSWER- - It can withstand higher temperatures without denaturing. What are the benefits of loading dye used for running DNA during gel electrophoresis? A) It helps the researcher to follow the progress of the gel. B) It allows DNA to fluoresce under UV light. C) It helps the DNA sink into the wells. D) It imparts an even charge along the DNA, allowing it to travel based on size alone. - - CORRECT ANSWER- - A and C Which is not an example of why a plasmid would be maintained in a cell? - - CORRECT ANSWER- - Organism keeps extra DNA in the case that it could become beneficial when introduced to novel environments

Why might a low copy number plasmid be useful for certain cloning projects? - - CORRECT ANSWER- - High copy plasmids may produce too much of a toxic protein. What happens if you accidentally shear the chromosomal DNA after adding P2 and N3? - - CORRECT ANSWER- - The fragments of the chromosome could be small enough to reanneal and go back into solution, contaminating your plasmid prep. What is unique about restriction sites cut by restriction enzymes? - - CORRECT ANSWER- - They tend to be palindromic. What is 1.3 mL in μL? - - CORRECT ANSWER- - 1300 How does the plasmid DNA bind to the filter? - - CORRECT ANSWER- - Positive charges on the filter allow binding. A research assistant utilizes the Qiagen plasmid DNA isolation procedure to isolate pBR322 plasmid DNA. Her lab runs out of the normal silica-based columns provided in the kit, so she substitutes a different column. The alternative column she uses binds DNA most efficiently in the size range from 70-100 Kb, and filters out all DNA less than 10 Kb. What is the expected yield for the plasmid pBR322? - - CORRECT ANSWER- - No pBR322 DNA You accidentally add DNAse instead of RNAse to buffer P1. How will this affect your plasmid purification? - - CORRECT ANSWER- - DNA will be degraded You are interested in amplifying a specific region of DNA to determine if a bacterium of interest is present. You set up and run a PCR reaction when viewing your results you see no band in your no-template control lane, but you see multiple bands in both your positive control and your experimental group. What went wrong? - - CORRECT ANSWER- - Non- specific binding of primers

What would you do to fix the problem you encountered in the question above? - - CORRECT ANSWER- - Raise the annealing temperature Imagine that while performing our Qiagen DNA extraction procedure, you forgot to add the EB solution. This could result in which of the following? - - CORRECT ANSWER- - The plasmid DNA would fail to elute from the silica. After you run your samples in your gel, you move it to the UV light only to find that no bands appear on your gel. Which of the following may have caused this? - - CORRECT ANSWER- - The positive and negative electrodes were reversed In order to centrifuge a tube containing 200 microliters of blue dye, it is necessary to: - - CORRECT ANSWER- - Fill a separate tube with 200 microliters of water and position the tubes directly opposite each other in the centrifuge. At 72°C, taq DNA polymerase will: - - CORRECT ANSWER- - Elongate the DNA sequence starting from the 3' end of the primer. The primer is elongated in which direction? - - CORRECT ANSWER- - 5' to 3' To increase the separation of the small sized bands in your DNA agarose gel, you want to: -

  • CORRECT ANSWER- - Increase the % agarose If you have purified a plasmid and want to amplify it in bacteria, what procedure do you want to do? - - CORRECT ANSWER- - Transformation What are the three main steps of the PCR reaction? What do they do? - - CORRECT ANSWER- - Denaturation separates the template strands. Annealing allows primers to bind to the target DNA.

Extension allows the polymerase to amplify the target DNA. You made a mistake, when you were setting the PCR cycle, you typed in 65°C instead of 95°C for the initial step of your PCR program. (Assume all other steps were set up correctly.) How would this adversely affect your reaction? What overall result would you get after your PCR cycle has run to completion? - - CORRECT ANSWER- - DNA double strands cannot be separated, so no replication can be achieved. You will get no PCR products. Cells capable of uptake of DNA are termed_______. - - CORRECT ANSWER- - Competent cells You have two choices of DNA loading dye. 1: bromophenol blue or 2: xylene cyanol FF. In TBE buffer, bromophenol blue runs at the same speed as a 370bp DNA fragment while xylene cyanol FF runs at the same speed as a 4160 bp DNA fragment. You have a PCR product which you expect to be 1000bp. Which loading dye would you use to add to your sample and run on the gel? Explain your answer. - - CORRECT ANSWER- - Choose Bromophenol blue because you want to make ensure that the DNA fragment of interest remains in the gel. What is the purpose of adding ethidium bromide to the agarose gel? - - CORRECT ANSWER-

  • To visualize the migrated DNA bands in a transilluminator You think your digestion did not work because on your gel you see 3 bands while you only expected to see 1 band. What could these 3 bands be assuming you are correct that the digestion did not work? - - CORRECT ANSWER- - Relaxed plasmid DNA, nicked plasmid, supercoiled plasmid What volumes are dispensed from a P20 displaying [1|8|0], a P1000 displaying [0|1|8], and a P100 displaying [0|1|8]? - - CORRECT ANSWER- - 18 μL, 180 μL, 18 μL

Use the vector map to propose 2 tests to verify that the plasmid you have been given is actually pUNK. - - CORRECT ANSWER- - A) RE digest, gel electrophoresis, check band sizes against vector map (check student answers to match map) B) antibiotic grow selection C) PCR If you ran a digest of pUNK (see previous question) using REs ScaI and BamHI, what would be the sizes of the resulting fragments? Identify the fragment that will migrate the furthest. -

  • CORRECT ANSWER- - A) 850, 750, 400 bp B) 400 bp band migrates furthest Pure culture methods are useful for: - - CORRECT ANSWER- - Isolating one type of bacteria from a bacterial mixture. What laboratory procedure is used to introduce plasmid into a bacterial cell? - - CORRECT ANSWER- - Transformation If you run a PCR reaction for 20 cycles, but only obtain 10 cycles worth of target DNA, what could have occurred? - - CORRECT ANSWER- - Not enough dNTPs were added Which dNTPs are needed for a PCR reaction? - - CORRECT ANSWER- - dATP dCTP dGTP dTTP Choose the aseptic technique that you would use to sterilize the following materials: - - CORRECT ANSWER- - Ionizing radiation or Toxic gases: Plastic bottles with low meting temperature. Autoclave: Trash bags filled with bacteria.

Filter bottle: Cell culture media which can not be autoclaved. A student forgets to add loading dye to his plasmid DNA samples prior to pipetting the samples into the wells of an agarose gel. Realizing his mistake, the student then adds the loading dye (without any DNA) directly to the same wells. Upon visualizing the gel under UV light, the student will likely see: - - CORRECT ANSWER- - No distinct DNA bands, since the DNA probably would not have remained in the wells upon loading. Is it possible to correctly estimate the size of an undigested circular plasmid using the regular standard ladders we use in lab? Please explain your response. - - CORRECT ANSWER- - No this is not possible. The standard ladders we use in class are for estimating linear DNA fragments. It would not be accurate to estimate the size of a circular fragment from a linear DNA standard.