LSUE BIOLOGY 1001 -with 100% verified solutions 2024-2025, Exams of Nursing

Download LSUE BIOLOGY 1001 -with 100% verified solutions 2024-2025 and more Exams Nursing in PDF only on Docsity! LSUE BIOLOGY 1001 -with 100% verified solutions 2024-2025 How many generations does it take to develop a new plant species by polyploid? A) one B) two C) ten D) about twenty A) one Both mitosis and meiosis are preceded by A) prometaphase B) interphase C) prophase D) telophase B) interphase Which of the following statements regarding the cell-cycle control system is false? A) The cell-cycle control system receives messages from outside the cell that influence cell division B) The cell-cycle control system triggers and controls major events in the cell cycle C) The cell-cycle control system includes three key checkpoints to complete a cell cycle D) The cell-cycle control system operates independently of the growth factors D) The cell-cycle control system operates independently of the growth factors Cancer is not usually inherited because A) the chromosomal changes in cancer are usually confined to somatic cells B) people with cancer usually die before reproducing A) the chromosomal changes cancer are usually confined to somatic cells Sister chromatids are A) found right after a cell divides B) joined together at a centromere C) made only of DNA D) unique to prokaryotes B) joined together at a centromere When animal cells are grown in a Petri dish, they typically stop diving once they have formed a single, unbroken layer on the bottom of the dish. This arrest of division is an example of A) cell constraint B) density-dependent inhibition C) cell division repression D) growth factor desensitization B) density dependent inhibition The process by which the cytoplasm of a eukaryotic cell divides to produce two cells is called A) mitosis B) cytokinesis C) binary fission D) telophase C) 2 D) 3 B) 1 Mendel's law of independent assortment states that A) chromosomes sort independently of each other during mitosis and meiosis B) independent sorting of genes produces polyploid plants under some circumstances C) each pair of alleles segregates independently of the other pairs of alleles during gamete formation C) each pair of alleles segregates independently of the other pairs of alleles during gamete formation Which of the following statements regarding genetic testing is false? A) genetic testing before birth requires the collection of fetal cells B) carrier testing helps determine if a person carries a potentially harmful disorder C) the screening of newborns can catch inherited disorders right after birth D) most human genetic diseases are treatable if caught early D) most human genetic diseases are treatable if caught early All the offspring of a cross between a black eyed mendelian and an orange eyed mendelian have black eyes. What is the expected phenotypic ration of a cross between two orange eye mendelians? A) 3 black eye: 1 orange eye B) 0 black eyed: 1 orange eyed C) 1 black eyed: 3 orange eyed D) 1 black eyed: 0 orange eyed B) 0 black eyed: 1 orange eyed How is sex determined in most ants and bees? A) by the XY system B) by the ZW system C) by the number of chromosomes D) by the size of the sex chromosomes C) by the number of chromosomes Which of the following terms refers to a situation where a single phenotypic character is determined by the additive effects of two or more genes? A) incomplete dominance B) codominance C) pleiotropy D) polygenic inheritance D) polygenic inheritance Amniocentesis and chorionic villus sampling allows for ____ and ____ of the fetus so that it can be tested for abnormalities A) imaging ...karyotyping B) sexing.... imaging C) karyotyping... biochemical testing D) direct observation.. biochemical testing D) direct observation.. biochemical testing A woman has been trying to conceive for several years, unsuccessfully. At a fertility clinic, they discover that she has blocked Fallopian tubes. Using modern technologies, some of her eggs are removed, fertilized with her husband's sperm, and implanted into her uterus. The procedure is successful, but the couple discovers that their son is color blind and the blood type O. The woman claims that the child can't be theirs since she has blood type A and her husband has blood type B. Also, neither parent is color blind, although one grand parent (the woman's father) is also color blind. As a genetic counselor, you would explain to the parent that A) the eggs must have been accidentally switched, since the baby's blood type has to match one of his parents B) each parent could have contributed one recessive allele, resulting in type O blood C) the eggs must have been accidentally switched, since a type A parent and a type B parent can have any type children except O D) it is possible for the baby to have type O blood, since type O is inherited through a dominant allele B) each parent could have contributed one recessive allele, resulting in type O blood According to scientist, about what percentage of men currently living in Central Asia may be descended from the Mongolian ruler Genghis Khan? A) 4% E) males need only one recessive allele from his mother to express the disorder E) males need only one recessive allele from his mother to express the disorder If a mRNA with nucleotide sequence as shown below is translated, what should be the right sequence of amino acids in a polypeptide? Refer to Genetic Code Table and use the 3 letters of amino acids to form the protein - 5'AUGUUAAGAGUCCGGAUUUAUGG3' A) Met Leu Arg Ala Pro Asp Leu Trp B) Met Leu Trp Leu Arg Ala Pro Asp C) Met Asp Leu Trp Leu Arg Ala Pro D) Met Arg Ala Pro Asp Leu Trp Leu E) Leu Trp Leu Arg Ala Pro Met Asp The directions for each amino acid in a polypeptide are indicated by a codon that consists of _____ nucleotide(s) in a RNA molecule A) 5 B) 4 C) 3 D) 2 3 One type of virus that infects bacteria is called a A) phage B) mage C) rhinovirus D) coronavirus A) phage The copying mechanism of DNA is most like A) using a photographic negative to make a positive image B) mixing flour, sugar, and water to make bread dough C) dripping water out of faucet D) carving a figure out of wood A) using a photographic negative to make a positive image Which of the following statements regarding a DNA double helix is always true? A) the amount of adenine is equal to the amount of uracil, and the amount of guanine is equal to the amount of cytosine B) the amount of adenine is equal to the amount of guanine, and the amount of thymine is equal to the amount of cytosine C) the amount of adenine is equal to the amount of cytosine, and the amount of guanine is equal to the amount of thymine D) the amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine D) the amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine Experiments have demonstrated that the "words" of the genetic code (the units that specify amino acids) are A) two nucleotides sequence B) sequences of anticodon C) three nucleotides sequences D) nucleotides sequences of various lengths E) single nucleotides C) three nucleotides sequences Hiv does the greatest damage to A) pancreatic cells B) white blood cells C) the adrenal glands D) red blood cells E) nervous tissue B) white blood cells A physical or chemical agent that changes the nucleotide sequence of DNA is called a A) codon B) anticodon C) mutagen D) terminator C) protein-RNA-DNA D) DNA-tRNA-mRNA-protein B) DNA-RNA-protein Which of the following is a function of a tRNA molecule? A) recognizing the appropriate anticodons in mRNA B) ransferring nucleotides to rRNA C) helping to translate codons into nucleic acids D) joining to only one specific type of amino acids D) joining to only one specific type of amino acid The "one gene one polypeptide" theory states that A) the synthesis of each gene is catalyzed by one specific enzyme B) the synthesis of each enzyme is catalyzed by one specific gene C) the function of an individual gene is to dictate the production of a specific polypeptide D) the function of each polypeptide is to regulate the synthesis of each corresponding gene C) the function of an individual gene is to dictate the production of a specific polypeptide When a T2 bacteriophage infects anEscherichia coli cell, which part of the phage enters the bacterial cytoplasm? A) the whole phage B) only the RNA C) only the DNA D) the protein "headpiece" and its enclosed nucleic acid C) the only DNA Imagine that you are studying a very large population of moths that is isolated from gene flow. A single gene controls wing color. Half of the moths have white spotted wings (genotype WW or Ww) and half of the moths have plain brown wings (ww). There are no new mutations, individuals mate randomly, and there is no natural selection on wing color. How will p, the frequency of the dominant allele, change over time? A) p will increase; the dominant allele will eventually take over and become most common in the population B) p will neither increase nor decrease; it will remain more or less constant under the conditions described C) p will decrease because of genetic drift D) p will fluctuate rapidly and randomly because of genetic drift B) p will neither increase nor decrease; it will remain more or less constant under the conditions described Frequency dependent selection, as seen in the case of the scale eating fish in Lake Tangayika, tends to A) maintain two phenotypes in a dynamic equilibrium in a population B) stimulate new mutations C) produce random changes in allele frequencies D) all the choices are correct E) eliminate rare alleles and favor whichever allele is initially most frequent A) maintain two phenotypes in a dynamic equilibrium in a population During the 1950s, a scientist named Lysenko tried to solve the food shortages in the Soviet Union by breeding wheat that could grow in Siberia. he theorized that if individual wheat plants were exposed to cold they would develop additional cold tolerance and pass it to their offspring. Based on the ideas of artificial and natural selection, do you think this project worked as planned? A) Yes, the wheat probably evolved better cold tolerance over time through inheritance of acquired characteristics B) No, because Lysenko took his wheat seeds straight to Siberia instead of exposing them incrementally to cold C) No, because there was no process of selection based on inherited traits. Lysenko assumed that exposure could induce a plant to develop additional cold tolerance and that this tolerance would be passed to the plants offspring D) Yes, because this is generally the method used by plant breeders to develop new crops E) None of the choices C) No, because there was no process of selection based on inherited traits. Lysenko assumed that exposure could induce a plant to develop additional cold tolerance and that this tolerance would be passed to the plants offspring A population of 1,000 birds exists on a small Pacific island. Some of the birds are yellow, a characteristic determine by a recessive allele. The others are green, a characteristic determined by a dominant allele. A hurricane on the island kills most of the birds from the population. Only ten remain, and those birds all have yellow feathers. Which of the following statements is true? A) intersexual selection B) intersexual selection C) disruptive selection D) stabilizing selection B) intersexual selection Aristotle believed that A) All of the choices are correct B) An individual's use of a body part causes it to further evolve C) species are fixed (permanent) and perfect D) species evolve through natural selection and other mechanisms E) the best evidence for change within species is seen in fossils C) species are fixed (permanent) and perfect Which of the following represents a pair of homologous structures? A) the wing of a bat and the scales of a fish B) the wing of a bat and the flipper of a whale C) the antennae of an insect and the eyes of a bird D) the wing of a bat and the wing of a butterfly B) the wing of a bat and the flipper of a whale Humans evolved with the disappearance of tail, despite the presence of tailbone. The tail in human is a A) Biochemical structure B) Vestigial structure C) Homologous structure D) Analogous structure E) All of the choices B) Vestigial structure In what rocks, fossils are found? A) Lava B) Metamorphic C) Sedimentary D) Magma E) Igneous C) Sedimentary Homologous structures such as the bones in wings, flippers, and arms are most closely concerned with A) comparative biochemistry B) anatomical similarity C) the fossil record D) biogeography E) comparative embryology B) anatomical similarity When body temperature is too high, which which of the following occurs? A) The brain sends out distress signals B) Blood vessels in the skin dilate C) Capillaries contract D) The internal lining of the intestine increases in surface area Which of the following is most likely to be responsible if, when your blood sugar level rises, the level of sugar goes back down? A) the use of the sugar for energy by your cells B) a homeostatic mechanism based on negative feedback C) type II diabetes D) a homeostatic mechanism based on positive feedback B) a homeostatic mechanism based on negative feedback Which of the following is a major category of animal tissue? A) epithelium B) heart C) lymph D) biceps A) epithelium E) All of the choices C) They are stratified squamous epithelial cells Suppose your doctor decides to X ray your hip. Which would show up more distinctly, the muscle or the bones? A) the muscles, because they re metabolically more active B) bones, because they have carbon C) the bones, because they are rich in hydrogen D) the bones, because they are denser E) the muscles, because they are softer D) the bones, because they are denser Under normal conditions, blood sugar levels are controlled within a narrow range by negative feedback. Two hormones are involved in maintaining blood sugar levels at the set point (about 90 mg of glucose/100 ml of blood). When blood sugar levels rise above the set point, the hormone insulin signals the liver to absorb the excess sugar. When blood sugar levels drop below the set point, the hormone glucagon signals the liver to release its stored glucose to the bloodstream. In juvenile onset diabetes, the body doesn't produce enough insulin and insulin supplements are required. Based on your understanding of homeostasis, for negative feedback control of blood glucose levels to function properly there must be sensors that monitor blood glucose levels The redwood groves in Northern California are one of America's greatest natural resources. Redwoods can live more than 2,000 years and grow taller than 350 feet. When tourism became popular in the late 1800s, large tunnels were cut through the center of several of these giant trees to allow wagons to pass through (and to attract tourists to the location). Even today, visitors wait in line to be photographed driving their cars through a tunnel. When the grovers were converted into national parks, the tunneling was discontinued, but several tunneled trees are still alive. When the redwood tunnels were first constructed, not much consideration was given to the long term effects of a tunnel on a tree's health. Nevertheless, many trees have survived more than 100 years after the tunnel was cut through their trunks. This is possible because A) the woods rays run in laterally through the trunk, so water and nutrients can still travel to all the tree's tissues B) the remaining heartwood is able to transport water and nutrients through the trunk C) the secondary xylem and phloem run vertically on either side of the vascular cambium and aren't completely disrupted by the tunnel D) mature cork cells are dead, so their loss doesn't disrupt nutrients and water transport C) the secondary xylem and phloem run vertically on either side of the vascular cambium and aren't completely disrupted by the tunnel Which of the following is a function of tracheids? A) food storage B) photosynthesis C) production of sex cells D) water conduction D) water conduction Which of the following statements about germination is false? A) The germination of a seed represents the beginning of life B) Germination usually begins when a seed takes up water C) A hydrated seed expands, rupturing its seed coat D) Germination usually takes place after a period of dormancy A) The germination of a seed represents the beginning of life Which of the following structures is the first to emerge from the germinating seed of a edict such as the garden bean? A) the embryonic shoot hook B) cotyledons C) the embryonic root D) the shoot sheath C) the embryonic root Which of the following is a disadvantage of cloning as a propagation technique? A) Cloning produces monocultures that can potentially be wiped out by a single disease B) Cloning is more expensive and more difficult than growing from seeds C) Cloning is time consuming, with slow results D) Cloned organisms are dangerous and unpredictable A) Cloning produces monocultures that can potentially be wiped out by a single disease E) usually via an insect, which places sperm in the ovary while proving for nectar C) via the pollen tube that grows from the pollen grain through the carpel tissues to the ovule What happens to the cotyledons of pea and maize seeds? A) They remain in the soil and decompose B) They form a protective sheath around the developing root system C) They surround the base of the shoot to provide additional strength D) They immediately begin to use the sun's energy in photosynthesis A) They remain in the soil and decompose In general, plant dermal tissues are found A) lining the vascular tissue B) lining of the vascular cambium C) throughout the plant body D) at the outer surface of a plant E) near the venter of the plant stems and roots D) at the outer surface of a plant Photosynthesis occurs in which type of plant tissue? A) parenchyma B) vascular cambium C) epidermal tissue D) collenchyma A) parenchyma While cleaning out the attic, you find a packed of seeds that your grandmother gathered from her garden. You plant them outside, and some of them sprout. What was the condition of these germinating seeds while they were in the attic? A) The endosperm cells were dead; the embryo cells were alive but inactive B) They were dead, but the embryo cells revived in response to water C) They were alive and very metabolically active D) They were alive but dormant D) They were alive but dormant Which of the following biomes is dominated by coniferous tree adapted to surviving long, hard winters and short, wet summers? A) coniferous forests B) tundra C) temperate broadleaf forest D) savanna A) coniferous forests Which of the following statements about temperate broadleaf forests is true? A) Temperate broadleaf forests have a narrow range of temperatures over the course of a year B) Oak, hickory, birch, beech, and maple are common trees in temperate broadleaf forests C) Temperature broadleaf forests have very poor soil D) Temperate broadleaf forests are less open than tropical rain forests B) Oak, hickory, birch, beech, and maple are common trees in temperate broadleaf forests The largest estuary in the United Staes is the Chesapeake Bay, which extends through six states, including Maryland, Virginia, and Pennsylvania. The bay is one of the most productive natural areas in the world. It is home to thousands of plants and animals, including many commercially important species. The water of the bay is relatively shallow. Many areas are no more than 10 feet deep, with an average depth of 30 feet. Light penetrates the shallow water and supports the submerged plants that provide food and shelter for the many species living in the bay ecosystem. However, like many estuaries, the bay receives large amounts of fertilizer runoff form farms, lawns, and wastewater treatment facilities. Fertilizer runoff contains______, which are the most important limiting factors for phytoplankton growth. A) carbon and hydrogen B) oxygen and carbon dioxide C) nitrogen and phosphorus D) sulfur and magnesium C) nitrogen and phosphorus The primary source of energy for hydrothermal vent communities is A) the heat of the water emerging from the vents B) oxidation of petroleum compounds in the vent water The major reason for tropical deforestation is A) hurricane destruction of large regions B) people clearing forests to open up land for agriculture C) governments clearing forests to build cities D) natural succession as global warming occurs B) people clearing forests to open up land for agriculture Species in widely separated biomes often appear to display similar characteristics because of A) convergent evolution B) coevolution C) mutations D) evolutionary drift E) speciation A) convergent evolution Shrublands in California, United States are called_____. A) Savanna B) Chaparral C) Prairie D) Brushes E) Bushes B) Chaparral Treeless biomes are treeless primarily because A) there is a lack of water or the water is frozen B) there is no source of seed dispersal C) trees are dependent upon the animals for support D) there is limited sunlight and limited water E) trees cannot withstand hot temperatures or below freezing cold A) there is a lack of water or the water is frozen All of the following affects the distribution of biomes EXCEPT A) global wind circulation B) distance above the sea level C) latitude D) soil type E) climate