(MB) ASCP PRACTICE EXAM|155 QUESTIONS WITH 100% CORRECT ANSWERS GRADED A+ (2023-2024), Exams of Nursing

Download (MB) ASCP PRACTICE EXAM|155 QUESTIONS WITH 100% CORRECT ANSWERS GRADED A+ (2023-2024) and more Exams Nursing in PDF only on Docsity!

(MB) ASCP PRACTICE EXAM|155 QUESTIONS WITH 100%

CORRECT ANSWERS GRADED A+ (2023- 2024 )

Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base - correct answers Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: - correct answers Thymine What genes would be screened in a breast cancer panel? - correct answers HER2, ERBB2, BRCA Next Generation Sequencing uses: - correct answers Short sequence reads

Purines and pyrimidines differ from each other in that: - correct answers Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine - correct answers Adenine and guanine What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs - correct answers 1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule

Size of the molecule Shape of the molecule Nucleotide sequence of the molecule - correct answers Nucleotide sequence of the molecule What are the phases in a qPCR Amplification Plot? Initiation, exponential, plateau Baseline, exponential, plateau Baseline, threshold, exponential, plateau Baseline, initiation, threshold, exponential, plateau - correct answers Initiation, exponential, plateau Find the palindrome in this restriction enzyme site: 5'-CTGCAG-3'? 5'-GAC 3'-GAC 3'-CTG 5'-GTC - correct answers 3'-GAC

A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single- gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient has Huntington Disease, HD. Which of the following would be consistent with this diagnosis? 25 CAG repeats in the Huntington gene 85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene - correct answers 85 CAG repeats in the Huntington gene Which two HPV types are responsible for most cases of cervical cancer? 16 and 18 31 and 59 16 and 58 44 and 59 - correct answers 16 and 18 Replication forks, known as origins of DNA replication, are created by this enzyme:

Ligase Taq Polymerase Primase Helicase - correct answers Helicase Mutation in what gene is associated with Fragile X syndrome? - correct answers FMR Mantle cell lymphoma (MCL) is caused by what translocation? - correct answers t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": - correct answers Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments - correct answers Okazaki fragments

What gene is measured following treatment with imatinib (Gleevec)? FLT BCR/Abl Jak MAPK - correct answers BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second - correct answers 50 nucleotides per second This polymerase is involved in "replicates mitochondrial DNA": - correct answers Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single- gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent

to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR - correct answers Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22 - 25ºC 2 - 8ºC

• 20ºC
• 70ºC - correct answers - 70 ºC Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel:

+/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp - correct answers m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 75°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer - correct answers Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? - correct answers DNA Ligase Next Generation Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones

Use of translation factors Hybridization - correct answers Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polymerase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit - correct answers Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, confirming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y - correct answers 1691G>A Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence?

60°C

58°C

64°C

62°C - correct answers 58 °C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II - correct answers RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: - correct answers Pleiotrophy

What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR - correct answers NASBA In what part of a qPCR Amplification Plot do you take your measurement? - correct answers Exponential phase All of the following are liquid tumors, except: Mantle cell lymphoma Ewing sarcoma Burkitt's lymphoma Acute promyelocytic leukemia - correct answers Ewing sarcoma

A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: - correct answers (2.545 * 50ng/mcl)= 127. (127.25ng/mcl * 0.30) = 38.175ng/mcl 38.175ng/mcl ( 0.800mL1000) = 3054 micrograms According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with: U or C A or G A, C or G Only A - correct answers A or G This polymerase acts on DNA and produces Messenger RNA: - correct answers RNA Pol II

What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase - correct answers Qβ replicase This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I - correct answers Type III What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap

Poly-A tail 5' Methionine Cap - correct answers 5' Methyl Cap A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - correct answers 50% The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA --> RNA --> Proteins DNA -->Proteins --> Genes RNA --> DNA --> Proteins RNA --> Proteins --> DNA - correct answers DNA --> RNA --> Proteins

What drug is NOT metabolized by CYP2D6? Codeine Omeprazole Warfarin Escitalopram - correct answers Warfarin You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation - correct answers Frame-shift mutation

A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 2 5% 50% 75% 100% - correct answers 100% Which DNA polymerase is responsible for copying DNA by reading existing strand, building new complementary strand and always adds to 3' end, but can't start a new strand on its own (ORI sites)? DNA Polymerase III DNA Polymerase I Gyrase None of the choices listed - correct answers DNA Polymerase III How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log 1log

2log 3log10 - correct answers 0.5log Which of the following is not a characteristic of a tRNA molecule? D arm Beta arm T arm Anti-codon arm - correct answers Beta arm This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): - correct answers t(9;22) What stain binds to minor groove of DNA Duplex? - correct answers SYBR Which of the following best characterizes a vector? helps carry DNA into cell ie plasmids, virus allows formation of double-stranded molecules

initiates replication during PCR decodes mRNA - correct answers helps carry DNA into cell ie plasmids, virus Between which phosphate groups is the linkage between the GTP molecule and RNA chain in the 5' cap? Beta-beta Alpha-gamma Gamma-beta Alpha-beta - correct answers Alpha-beta This restriction enzyme "digests and removes a methyl group from Adenine": Type I Type II Type III DNase I - correct answers Type I Primer dimers are due to what complimentary issue? 3' to 3' complementarity of primer pairs

3' to 5' complementarity of primer pairs 5' to 5' complementarity of primer pairs 5' to 3' complementarity of primer pairs - correct answers 3' to 3' complementarity of primer pairs The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? C1' C2' C3' C4' - correct answers C3' Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors that that can influence this process. G:C ratio of bases pH of the hybridization reaction Hybridization temperature All of the above - correct answers All of the above

A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: 76.35 micrograms/mL 3817.5 micrograms/mL 381.75 micrograms/mL 3054.0 micrograms/mL - correct answers 3817.5 micrograms/mL Mutation in UGT1A1 affects metabolism of what drug? - correct answers Ironotecan Testing for HOXB13, BRCA1 and BCRA2 is usually done in patients with: - correct answers Prostate cancer RT-PCR can be used to quantify messenger RNA (mRNA) among other uses. All of the following concerning RT-PCR are true, EXCEPT: RT-PCR is useful in detecting RNA-viruses, such as HIV RT-PCR uses alkaline phosphatase to reverse amplify the signal RT-PCR produces cDNA using RNA templates - correct answers RT-PCR uses alkaline phosphatase to reverse amplify the signal

Southern blot can be used for all of the following purposes, except: Paternity testing Chromosomal staining Gene discovery and mapping Mutation analysis and identification - correct answers Chromosomal staining If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer? A vegetarian diet Never having been pregnant Obesity Smoking - correct answers Smoking Which of the following is not a common hydrogen bond acceptor? A carbonyl Primary amine Hydroxyl

Tertiary amine - correct answers Primary amine T-Cell Gene Rearrangement is seen in what malignancy? Sézary syndrome Burkitt's lymphoma Non-Hodgkin Lymphoma Polycythemia vera - correct answers Non-Hodgkin Lymphoma The t(11;22) translocation is responsible for: - correct answers Ewing sarcoma In CML, what fusion protein is created? EWS-FLI1 EWS-PAR2 BCR-Abl1 c-myc-IGH - correct answers BCR-Abl1

As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task? Nested PCR Real-time PCR NASBA Multiplex PCR - correct answers Multiplex PCR All of the following methods of amplification are considered target amplification, except: Quantitative PCR NASBA Strand Displacement Amplification Reverse Transcriptase PCR - correct answers NASBA Which of the following reagents will successfully decontaminate a bench top that has been exposed to DNA amplification products?

70% Ethanol 5% Bleach 100% Isopropanol 10% Methanol - correct answers 5% Bleach All of the following are components of nucleic acids, EXCEPT: Phosphate group Sugar (ribose or deoxyribose) Nitrogenous base (A, G, C, T) Formamide - correct answers Formamide The amelogenin locus, found on the sex chromosomes, is used in gender identification. Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification were part of a gender identification procedure, what would be the gender of the individual? Male Female Hermaphrodite

Can't be determined from the given information - correct answers Male What assay amplifies the target using DNA polymerase? Branched DNA TMA PCR NASBA LCR - correct answers PCR During DNA replication, the 3' - OH of the growing DNA chain attacks which phosphate of an incoming nucleotide? Alpha Beta Gamma Delta - correct answers Beta What gene is measured following treatment with Warfarin? FLT3