ASCP Exam Prep: Molecular Biology & Genetics Practice Questions, Exams of Nursing

Download ASCP Exam Prep: Molecular Biology & Genetics Practice Questions and more Exams Nursing in PDF only on Docsity!

Answers Verified (2023-2024) (155 Questions)

Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base - correct answers ✅Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: - correct answers ✅Thymine What genes would be screened in a breast cancer panel? - correct answers ✅HER2, ERBB2, BRCA Next Generation Sequencing uses: - correct answers ✅Short sequence reads Purines and pyrimidines differ from each other in that: - correct answers ✅Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine - correct answers ✅Adenine and guanine

Answers Verified (2023-2024) (155 Questions)

What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs - correct answers ✅1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the molecule Nucleotide sequence of the molecule - correct answers ✅Nucleotide sequence of the molecule What are the phases in a qPCR Amplification Plot? Initiation, exponential, plateau Baseline, exponential, plateau

Answers Verified (2023-2024) (155 Questions)

85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene - correct answers ✅85 CAG repeats in the Huntington gene Which two HPV types are responsible for most cases of cervical cancer? 16 and 18 31 and 59 16 and 58 44 and 59 - correct answers ✅16 and 18 Replication forks, known as origins of DNA replication, are created by this enzyme: Ligase Taq Polymerase Primase Helicase - correct answers ✅Helicase

Answers Verified (2023-2024) (155 Questions)

Mutation in what gene is associated with Fragile X syndrome? - correct answers ✅FMR Mantle cell lymphoma (MCL) is caused by what translocation? - correct answers ✅t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": - correct answers ✅Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments - correct answers ✅Okazaki fragments What gene is measured following treatment with imatinib (Gleevec)? FLT BCR/Abl

Answers Verified (2023-2024) (155 Questions)

Standard PCR PFGE RAPD PCR - correct answers ✅Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC - correct answers ✅-70ºC Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp;

Answers Verified (2023-2024) (155 Questions)

m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp - correct answers ✅m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 75°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer - correct answers ✅Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? - correct answers ✅DNA Ligase Next Generation Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors

Answers Verified (2023-2024) (155 Questions)

Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C - correct answers ✅ 58 °C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II - correct answers ✅RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the

Answers Verified (2023-2024) (155 Questions)

expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: - correct answers ✅Pleiotrophy What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR - correct answers ✅NASBA In what part of a qPCR Amplification Plot do you take your measurement? - correct answers ✅Exponential phase All of the following are liquid tumors, except: Mantle cell lymphoma

Answers Verified (2023-2024) (155 Questions)

A or G A, C or G Only A - correct answers ✅A or G This polymerase acts on DNA and produces Messenger RNA: - correct answers ✅RNA Pol II What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase - correct answers ✅Qβ replicase This restriction enzyme "digests and adds a methyl group from Adenine": Type I

Answers Verified (2023-2024) (155 Questions)

Type II Type III DNase I - correct answers ✅Type III What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap Poly-A tail 5' Methionine Cap - correct answers ✅5' Methyl Cap A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - correct answers ✅50%

Answers Verified (2023-2024) (155 Questions)

The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation - correct answers ✅Frame-shift mutation A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - correct answers ✅100% Which DNA polymerase is responsible for copying DNA by reading existing strand, building new complementary strand and always adds to 3' end, but can't start a new strand on its own (ORI sites)? DNA Polymerase III

Answers Verified (2023-2024) (155 Questions)

DNA Polymerase I Gyrase None of the choices listed - correct answers ✅DNA Polymerase III How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log 1log 2log 3log10 - correct answers ✅0.5log Which of the following is not a characteristic of a tRNA molecule? D arm Beta arm T arm Anti-codon arm - correct answers ✅Beta arm

Answers Verified (2023-2024) (155 Questions)

This restriction enzyme "digests and removes a methyl group from Adenine": Type I Type II Type III DNase I - correct answers ✅Type I Primer dimers are due to what complimentary issue? 3' to 3' complementarity of primer pairs 3' to 5' complementarity of primer pairs 5' to 5' complementarity of primer pairs 5' to 3' complementarity of primer pairs - correct answers ✅3' to 3' complementarity of primer pairs The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? C1' C2'

Answers Verified (2023-2024) (155 Questions)

C3'

C4' - correct answers ✅C3' Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors that that can influence this process. G:C ratio of bases pH of the hybridization reaction Hybridization temperature All of the above - correct answers ✅All of the above A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: 76.35 micrograms/mL 3817.5 micrograms/mL 381.75 micrograms/mL 3054.0 micrograms/mL - correct answers ✅3817.5 micrograms/mL