ASCP Practice Exam Questions and Answers, Exams of Health sciences

Download ASCP Practice Exam Questions and Answers and more Exams Health sciences in PDF only on Docsity! (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base - correct answers ✅Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: - correct answers ✅Thymine What genes would be screened in a breast cancer panel? - correct answers ✅HER2, ERBB2, BRCA1 Next Generation Sequencing uses: - correct answers ✅Short sequence reads Purines and pyrimidines differ from each other in that: - correct answers ✅Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Adenine and guanine - correct answers ✅Adenine and guanine What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs - correct answers ✅1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the molecule Nucleotide sequence of the molecule - correct answers ✅Nucleotide sequence of the molecule (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) 44 and 59 - correct answers ✅16 and 18 Replication forks, known as origins of DNA replication, are created by this enzyme: Ligase Taq Polymerase Primase Helicase - correct answers ✅Helicase Mutation in what gene is associated with Fragile X syndrome? - correct answers ✅FMR1 Mantle cell lymphoma (MCL) is caused by what translocation? - correct answers ✅t(11;14) (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) This polymerase is involved in "initiation of DNA replication and has primase activity": - correct answers ✅Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments - correct answers ✅Okazaki fragments What gene is measured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK - correct answers ✅BCR/Abl (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second - correct answers ✅50 nucleotides per second This polymerase is involved in "replicates mitochondrial DNA": - correct answers ✅Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow- up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Next Generation Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization - correct answers ✅Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polymerase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit - correct answers ✅Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, confirming the presence of the (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y - correct answers ✅1691G>A Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C - correct answers ✅58°C This polymerase acts on DNA and produces Ribosomal RNA: (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) RNA Pol I DNA Pol I RNA Pol II DNA Pol II - correct answers ✅RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: - correct answers ✅Pleiotrophy What assay amplifies the target using a combination of a three-enzyme system? (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Only A - correct answers ✅A or G This polymerase acts on DNA and produces Messenger RNA: - correct answers ✅RNA Pol II What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase - correct answers ✅Qβ replicase This restriction enzyme "digests and adds a methyl group from Adenine": Type I (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Type II Type III DNase I - correct answers ✅Type III What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap Poly-A tail 5' Methionine Cap - correct answers ✅5' Methyl Cap A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) 100% - correct answers ✅50% The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA --> RNA --> Proteins DNA -->Proteins --> Genes RNA --> DNA --> Proteins RNA --> Proteins --> DNA - correct answers ✅DNA --> RNA --> Proteins What drug is NOT metabolized by CYP2D6? Codeine Omeprazole Warfarin Escitalopram - correct answers ✅Warfarin You have sequenced a gene and observe the following: (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) 3log10 - correct answers ✅0.5log10 Which of the following is not a characteristic of a tRNA molecule? D arm Beta arm T arm Anti-codon arm - correct answers ✅Beta arm This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): - correct answers ✅t(9;22) What stain binds to minor groove of DNA Duplex? - correct answers ✅SYBR1 Which of the following best characterizes a vector? helps carry DNA into cell ie plasmids, virus (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) allows formation of double-stranded molecules initiates replication during PCR decodes mRNA - correct answers ✅helps carry DNA into cell ie plasmids, virus Between which phosphate groups is the linkage between the GTP molecule and RNA chain in the 5' cap? Beta-beta Alpha-gamma Gamma-beta Alpha-beta - correct answers ✅Alpha-beta This restriction enzyme "digests and removes a methyl group from Adenine": Type I Type II Type III (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) DNase I - correct answers ✅Type I Primer dimers are due to what complimentary issue? 3' to 3' complementarity of primer pairs 3' to 5' complementarity of primer pairs 5' to 5' complementarity of primer pairs 5' to 3' complementarity of primer pairs - correct answers ✅3' to 3' complementarity of primer pairs The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? C1' C2' C3' C4' - correct answers ✅C3' (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Gene discovery and mapping Mutation analysis and identification - correct answers ✅Chromosomal staining If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer? A vegetarian diet Never having been pregnant Obesity Smoking - correct answers ✅Smoking Which of the following is not a common hydrogen bond acceptor? A carbonyl Primary amine Hydroxyl Tertiary amine - correct answers ✅Primary amine (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) T-Cell Gene Rearrangement is seen in what malignancy? Sézary syndrome Burkitt's lymphoma Non-Hodgkin Lymphoma Polycythemia vera - correct answers ✅Non-Hodgkin Lymphoma The t(11;22) translocation is responsible for: - correct answers ✅Ewing sarcoma In CML, what fusion protein is created? EWS-FLI1 EWS-PAR2 BCR-Abl1 c-myc-IGH - correct answers ✅BCR-Abl1 (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task? Nested PCR Real-time PCR NASBA Multiplex PCR - correct answers ✅Multiplex PCR All of the following methods of amplification are considered target amplification, except: Quantitative PCR NASBA (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) During DNA replication, the 3' -OH of the growing DNA chain attacks which phosphate of an incoming nucleotide? Alpha Beta Gamma Delta - correct answers ✅Beta What gene is measured following treatment with Warfarin? FLT3 VKORC1 MAPK P53 - correct answers ✅VKORC1 The process of making proteins is termed: Replication (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Translation Transcription Sequencing - correct answers ✅Translation How many polymorphisms can be found in the human genome? Approximately 10 million Approximately 100 thousand Approximately 1 billion Approximately 1 million - correct answers ✅Approximately 10 million This highly polymorphic loci region is crucial in assessing immune system compatibility: VNTRs HLA SINES SNPs - correct answers ✅HLA (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 5'-ATCTATGTCGGCAATT-3' 5'-TTAACGGCTGTATCTA-3' 5'-AATTGCCGACATAGAT-3' 5'-GAGCACGCTATCTTAT-3' - correct answers ✅5'-ATCTATGTCGGCAATT-3' Mutations in the CFTR gene is associated with what disease? Fragile X Cystic Fibrosis Sickle-cell anemia Mantle Cell Lymphoma - correct answers ✅Cystic Fibrosis The mother of a 3 year old boy took him to the doctor's office for concerns of an underlying genetic condition. A karyotype order was sent to the (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) What is the most common mutation in Hemochromatosis? 1691G>A F508del R506Q C282Y - correct answers ✅C282Y Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy: Dystrophin P53 Musculin C-myc - correct answers ✅Dystrophin What is the sequence recognized by poly (A) polymerase? TATAAA CAA (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) CCCGAA AAUAAA - correct answers ✅AAUAAA Splicing is the process that does which of the following? Remove exons and preserve introns Remove introns and preserve exons Remove mutated regions of primary transcript RNA (tRNA)? Add a poly-A tail to the end of a primary RNA transcript? - correct answers ✅Remove introns and preserve exons Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer) -At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature. -When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored. - correct answers ✅-At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature. Acute promyelocytic leukemia (APL) is responsible for what translocation? - correct answers ✅t(15;17) What genes would be screened in a colorectal panel? (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) PCR NASBA LCR - correct answers ✅Branched DNA What genes would be screened in a lung cancer panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA1 KRAS, EGFR, ALK MSH2, PMS2, EPCAM - correct answers ✅KRAS, EGFR, ALK Which of the following molecular methodologies would be the best for detecting a trinucleotide repeat disorder such as Huntington's disease? Heteroduplex analysis Variable number tandem repeat analysis Single strand conformation polymorphism analysis (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Reverse-Transcriptase PCR - correct answers ✅Variable number tandem repeat analysis Which method would best be used to detect the Leiden mutation? PCR-RFLP bDNA amplification PFGE Ribotyping - correct answers ✅PCR-RFLP Which of the following is not a step in the Southern blot procedure? DNA digest with restriction enzymes Gel resolution of fragments Fragments denaturation Probe digest - correct answers ✅Probe digest (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Bone marrow transplantation is a great method used to treat several malignant and benign cancers, particularly leukemias. Before transplantation (or engraftment analysis), several polymorphic loci are screened in both the recipient and donor cells. The main goal of this screening is to: -find at least one or more informative loci between both the donor and recipient -find exactly ten informative loci between both the donor and recipient -find all the non-informative loci between both the donor and recipient -find the blood type/group of both the donor and recipient - correct answers ✅find at least one or more informative loci between both the donor and recipient A DNA specimen was sent to your Molecular Diagnostics Laboratory for DNA sequencing, in order to determine whether patient A has a particular mutation in gene X. The gene sequence is known. However, the gene mutation itself is not known. Therefore, DNA sequencing cannot be performed on this DNA specimen. (True or False) (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) What is the optimum storage condition for any specimen (whole blood, bone marrow, tissue etc.) awaiting RNA extraction? -Remove contaminating RBCs then immediately freeze at -20°C -Prepare a lyophilized cell pellet and store at room temperature -Refrigerate at 4°C indefinitely - correct answers ✅Remove contaminating RBCs then immediately freeze at -20°C Which of the following is not a PCR step? Denaturation Elongation Annealing Termination - correct answers ✅Termination Which PCR method has the highest specificity? qPCR Touchdown PCR (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Nested PCR Two-step PCR - correct answers ✅Nested PCR All of the following enzymes are part of the DNA replication machinery, EXCEPT: Ligase DNA polymerase Luciferase Helicase - correct answers ✅Luciferase What is the name of the molecule that is added to the 5' end of eukaryotic RNA transcripts? ATP SnRNP GTP Phosphate - correct answers ✅GTP (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) What is multiplex PCR? -A PCR technique to amplify multiple targets -A PCR technique where a preamplified amplicon is amplified to increase sensitivity -A PCR technique where a preamplified amplicon is amplified to increase sensitivity A PCR technique that combines reverse transcription and amplification in one reaction -A PCR technique where various samples can be amplified in one reaction - correct answers ✅A PCR technique to amplify multiple targets Codons that code for the same amino acid are called: Synonyms Similar Degenerates (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Ribotyping - correct answers ✅Ribotyping The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? C1' C2' C3' C5' - correct answers ✅C1' Which of the following is not a mutation found in the HFE gene of hemochromatosis? C282Y H63D 5382insC S65C - correct answers ✅5382insC (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Clinical laboratories must have clearly written protocols in place describing handling of specimens for clinical testing. Many factors can affect testing performance before the actual testing is conducted. Such factors or variables are collectively known as pre-analytical. From the list below, select all the pre-analytical variables that can have a negative impact on clinical testing (Hint: more than one answer choice!) -Storage conditions -Patient identifiers -Anticoagulant in collection tubes -Transport procedures -Introduction of Heparin in all blood tubes to maintain specimen integrity for testing -Thermo cycling parameters -DNA isolation method used -Testing analysis software used - correct answers ✅-Storage conditions -Patient identifiers (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) -Anticoagulant in collection tubes -Transport procedures What translocation is associated with Burkitt's lymphoma? - correct answers ✅t(8;14) What does the term consanguinity refer to? -The lines on a pedigree used to show relationships between siblings -The first affected family member coming to medical attention -The line of descent on a pedigree used to show relationships between parents and children -Individuals that share a common ancestor or are considered "of the same blood" -Neither of the listed choices - correct answers ✅-Individuals that share a common ancestor or are considered "of the same blood" (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them! Thermosequenase Helicase Primase Ligase - correct answers ✅Ligase In which of the following methods is the probe digested by the polymerase (Taq) during primer extension? Taqman FRET probes Molecular beacons Scorpion probes - correct answers ✅Taqman Which of the following is not a source of DNA damage? (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Chemical damage Splicing Attack by water Radiation damage - correct answers ✅Splicing All of the following are trinucleotide repeat disorders, EXCEPT: Spinocerebellar Ataxia Type 8 Huntington Disease Asperger Disease Fragile X Disease - correct answers ✅Asperger Disease This polymerase is involved in "short-patch base excision repair": Pol α Pol β Pol γ (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Pol δ - correct answers ✅Pol β You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCTGctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation - correct answers ✅Insertion The 5' capping process creates what type of linkage? (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Helicase Primase - correct answers ✅RNA Polymerase What is the predominant form of DNA? A Form B Form Z Form G Form - correct answers ✅B Form Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab? -To ensure that all equipment is being utilized to its full potential -To prevent amplified products from entering the post-PCR detection area of the laboratory -To avoid contamination of specimens with amplified product which create false positive results (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) -To allow "dirty"(or infected) patient samples to become decontaminated before running an assay - correct answers ✅-To avoid contamination of specimens with amplified product which create false positive results In a retrovirus the RNA acts as: Genome and mRNA mRNA Genome rRNA - correct answers ✅Genome and mRNA Imagine you are working in specimen processing for the molecular laboratory and you receive a patient's specimen collected in a lavender top vacutainer tube containing EDTA. The test that is ordered requires that the specimen be collected in a yellow top ACD vacutainer tube. What is the BEST action to take in this instance? -Reject the specimen, inform the supervisor and request a new specimen drawn in ACD (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) -Process the sample according to laboratory protocol because EDTA does not interfere with molecular testing methods -Document the tube additive change, process the sample, run the test, and hold the results until a supervisor or laboratory director signs off -Follow the prescribed laboratory protocol for accepting and rejecting specimens -Both B & D are correct -Both C & D are correct - correct answers ✅-Follow the prescribed laboratory protocol for accepting and rejecting specimens Which of the following is not involved in the splicing reaction? 5' splice site Hairpin loops Branch A point 3' splice site - correct answers ✅Hairpin loops (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) What volume of DNA (in microliters) is required to prepare a restriction digest that requires 10 µgs of DNA when the stock DNA is 5 µg/µl? 0.5 µl 1 µl 2 µl 5 µl - correct answers ✅2 µl Which one of the following complementary pairings is incorrect? A=T G=C U=T A=U - correct answers ✅U=T What is the advantage of Next Generation Sequencing (NGS) over traditional Sanger Sequencing? (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) -Ability to sequence multiple mutation variants of a single gene at a single time -Preparation of a library -Easy setup -Use of a barcode reader - correct answers ✅Ability to sequence multiple mutation variants of a single gene at a single time What links codons and anti-codons together during DNA translation? DNA ligase Single-stranded binding protein Complementary base pairing GTP - correct answers ✅Complementary base pairing Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents combined have to pass down this affected gene to their child? (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) 0% 25% 50% 75% 100% - correct answers ✅75% A cerebrospinal fluid (CSF) sample for hematologic evaluation should be tested within how many hours of collection? 1 hour 2 hours 3 hours 4 hours - correct answers ✅1 hour Blood drawn into what type of tube is compatible for Genetic testing? K2EDTA tube Sodium citrate tube