ASCP Practice Exam Questions With 100% Correct Answers Verified, Exams of Nursing

Download ASCP Practice Exam Questions With 100% Correct Answers Verified and more Exams Nursing in PDF only on Docsity! (MB) ASCP Practice Exam Questions With 100% Correct Answers Verified (2023-2024) (155 Questions) Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base - correct answers ✅Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: - correct answers ✅Thymine What genes would be screened in a breast cancer panel? - correct answers ✅HER2, ERBB2, BRCA1 Next Generation Sequencing uses: - correct answers ✅Short sequence reads Purines and pyrimidines differ from each other in that: - correct answers ✅Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine - correct answers ✅Adenine and guanine What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs - correct answers ✅1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the molecule Nucleotide sequence of the molecule - correct answers ✅Nucleotide sequence of the molecule What are the phases in a qPCR Amplification Plot? Initiation, exponential, plateau Baseline, exponential, plateau Mantle cell lymphoma (MCL) is caused by what translocation? - correct answers ✅t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": - correct answers ✅Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments - correct answers ✅Okazaki fragments What gene is measured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK - correct answers ✅BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second - correct answers ✅50 nucleotides per second This polymerase is involved in "replicates mitochondrial DNA": - correct answers ✅Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow- up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR - correct answers ✅Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC - correct answers ✅-70ºC Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp - correct answers ✅m/+ = 350 bp; 250 bp; 100 bp 58°C 64°C 62°C - correct answers ✅58°C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II - correct answers ✅RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: - correct answers ✅Pleiotrophy What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR - correct answers ✅NASBA In what part of a qPCR Amplification Plot do you take your measurement? - correct answers ✅Exponential phase All of the following are liquid tumors, except: Mantle cell lymphoma Ewing sarcoma Burkitt's lymphoma Acute promyelocytic leukemia - correct answers ✅Ewing sarcoma A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: - correct answers ✅(2.545 * 50ng/mcl)= 127.25 (127.25ng/mcl * 0.30) = 38.175ng/mcl 38.175ng/mcl ( 0.800mL1000) = 3054 micrograms According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with: U or C A or G A, C or G Only A - correct answers ✅A or G What drug is NOT metabolized by CYP2D6? Codeine Omeprazole Warfarin Escitalopram - correct answers ✅Warfarin You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation - correct answers ✅Frame-shift mutation A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - correct answers ✅100% Which DNA polymerase is responsible for copying DNA by reading existing strand, building new complementary strand and always adds to 3' end, but can't start a new strand on its own (ORI sites)? DNA Polymerase III DNA Polymerase I Gyrase None of the choices listed - correct answers ✅DNA Polymerase III How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log10 1log10 2log10 3log10 - correct answers ✅0.5log10 Which of the following is not a characteristic of a tRNA molecule? D arm Beta arm T arm Anti-codon arm - correct answers ✅Beta arm This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): - correct answers ✅t(9;22) What stain binds to minor groove of DNA Duplex? - correct answers ✅SYBR1 Which of the following best characterizes a vector? helps carry DNA into cell ie plasmids, virus A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: 76.35 micrograms/mL 3817.5 micrograms/mL 381.75 micrograms/mL 3054.0 micrograms/mL - correct answers ✅3817.5 micrograms/mL Mutation in UGT1A1 affects metabolism of what drug? - correct answers ✅Ironotecan Testing for HOXB13, BRCA1 and BCRA2 is usually done in patients with: - correct answers ✅Prostate cancer RT-PCR can be used to quantify messenger RNA (mRNA) among other uses. All of the following concerning RT-PCR are true, EXCEPT: RT-PCR is useful in detecting RNA-viruses, such as HIV RT-PCR uses alkaline phosphatase to reverse amplify the signal RT-PCR produces cDNA using RNA templates - correct answers ✅RT-PCR uses alkaline phosphatase to reverse amplify the signal Southern blot can be used for all of the following purposes, except: Paternity testing Chromosomal staining Gene discovery and mapping Mutation analysis and identification - correct answers ✅Chromosomal staining If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer? A vegetarian diet Never having been pregnant Obesity Smoking - correct answers ✅Smoking Which of the following is not a common hydrogen bond acceptor? A carbonyl Primary amine Hydroxyl Tertiary amine - correct answers ✅Primary amine T-Cell Gene Rearrangement is seen in what malignancy? Sézary syndrome Burkitt's lymphoma Non-Hodgkin Lymphoma Polycythemia vera - correct answers ✅Non-Hodgkin Lymphoma The t(11;22) translocation is responsible for: - correct answers ✅Ewing sarcoma In CML, what fusion protein is created? EWS-FLI1 EWS-PAR2 BCR-Abl1 base pairs. If this amplification were part of a gender identification procedure, what would be the gender of the individual? Male Female Hermaphrodite Can't be determined from the given information - correct answers ✅Male What assay amplifies the target using DNA polymerase? Branched DNA TMA PCR NASBA LCR - correct answers ✅PCR During DNA replication, the 3' -OH of the growing DNA chain attacks which phosphate of an incoming nucleotide? Alpha Beta Gamma Delta - correct answers ✅Beta What gene is measured following treatment with Warfarin? FLT3 VKORC1 MAPK P53 - correct answers ✅VKORC1 The process of making proteins is termed: Replication Translation Transcription Sequencing - correct answers ✅Translation How many polymorphisms can be found in the human genome? Approximately 10 million Approximately 100 thousand Approximately 1 billion Approximately 1 million - correct answers ✅Approximately 10 million This highly polymorphic loci region is crucial in assessing immune system compatibility: VNTRs HLA SINES SNPs - correct answers ✅HLA Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 5'-ATCTATGTCGGCAATT-3' 5'-TTAACGGCTGTATCTA-3' 5'-AATTGCCGACATAGAT-3' 5'-GAGCACGCTATCTTAT-3' - correct answers ✅5'-ATCTATGTCGGCAATT-3' Mutations in the CFTR gene is associated with what disease? Fragile X Cystic Fibrosis What is the most common mutation in Hemochromatosis? 1691G>A F508del R506Q C282Y - correct answers ✅C282Y Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy: Dystrophin P53 Musculin C-myc - correct answers ✅Dystrophin What is the sequence recognized by poly (A) polymerase? TATAAA CAA CCCGAA AAUAAA - correct answers ✅AAUAAA Splicing is the process that does which of the following? Remove exons and preserve introns Remove introns and preserve exons Remove mutated regions of primary transcript RNA (tRNA)? Add a poly-A tail to the end of a primary RNA transcript? - correct answers ✅Remove introns and preserve exons Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer) -At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature. -When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored. - correct answers ✅-At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature. Acute promyelocytic leukemia (APL) is responsible for what translocation? - correct answers ✅t(15;17) What genes would be screened in a colorectal panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA1 KRAS, EGFR, ALK MSH2, PMS2, EPCAM - correct answers ✅KRAS, BRAF, PIK3CA What responds poorly to Ribavarin/Interferon treatment? HCV type 1 HCV type 2 Heteroduplex analysis Variable number tandem repeat analysis Single strand conformation polymorphism analysis Reverse-Transcriptase PCR - correct answers ✅Variable number tandem repeat analysis Which method would best be used to detect the Leiden mutation? PCR-RFLP bDNA amplification PFGE Ribotyping - correct answers ✅PCR-RFLP Which of the following is not a step in the Southern blot procedure? DNA digest with restriction enzymes Gel resolution of fragments Fragments denaturation Probe digest - correct answers ✅Probe digest Bone marrow transplantation is a great method used to treat several malignant and benign cancers, particularly leukemias. Before transplantation (or engraftment analysis), several polymorphic loci are screened in both the recipient and donor cells. The main goal of this screening is to: -find at least one or more informative loci between both the donor and recipient -find exactly ten informative loci between both the donor and recipient -find all the non-informative loci between both the donor and recipient -find the blood type/group of both the donor and recipient - correct answers ✅find at least one or more informative loci between both the donor and recipient A DNA specimen was sent to your Molecular Diagnostics Laboratory for DNA sequencing, in order to determine whether patient A has a particular mutation in gene X. The gene sequence is known. However, the gene mutation itself is not known. Therefore, DNA sequencing cannot be performed on this DNA specimen. (True or False) True False - correct answers ✅True After an amplification procedure followed by gel electrophoresis, you took a photo of your gel. You notice consistent bands in all your gel lanes. However, you also see what appears to be a faint but noticeable band in your reagent blank lane. What is your best explanation for the reagent blank band? -Taq polymerase concentration was too low in this PCR reaction -There was obvious contamination in this PCR reaction -The primers concentration was too high in this PCR reaction -The dNTPs concentration was too high in this PCR reaction - correct answers ✅There was obvious contamination in this PCR reaction In mantle cell lymphoma (MCL), this is the fusion gene created: EWS-FLI1 CCND1-IGH BCR-IGH c-myc-EWS - correct answers ✅CCND1-IGH This enzyme is known for "unzipping" genes! Alkaline Phosphatase RNA polymerase ATP SnRNP GTP Phosphate - correct answers ✅GTP What is multiplex PCR? -A PCR technique to amplify multiple targets -A PCR technique where a preamplified amplicon is amplified to increase sensitivity -A PCR technique where a preamplified amplicon is amplified to increase sensitivity A PCR technique that combines reverse transcription and amplification in one reaction -A PCR technique where various samples can be amplified in one reaction - correct answers ✅A PCR technique to amplify multiple targets Codons that code for the same amino acid are called: Synonyms Similar Degenerates Complements - correct answers ✅Synonyms When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as approximately: ΔCt = 1 ΔCt = 3.3 ΔCt = 10 ΔCt = 6.6 - correct answers ✅ΔCt = 3.3 Deletion in the paternal chromosome 15: del(15)(q11q13) results in Prader- willi syndrome. However, deletion in the same region in the maternal chromosome results in a completely different condition known as Angelman syndrome. This phenomenon is an example of: Mosaicism Loss of heterozygosity Hemizygosity Genomic imprinting - correct answers ✅Genomic imprinting What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer? - correct answers ✅t(18;X) Testing for Aldehyde Dehydrogenase deficiency is important in patients with: Alcohol dependence Diabetis Lactic acidosis Obesity - correct answers ✅Alcohol dependence You could use all of the following methods to test for the the t(9;22) translocation, except: FISH Southern blot Reverse-transcriptase PCR Ribotyping - correct answers ✅Ribotyping The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? C1' -Individuals that share a common ancestor or are considered "of the same blood" -Neither of the listed choices - correct answers ✅-Individuals that share a common ancestor or are considered "of the same blood" There are many types of RNA molecules, each of which has a specific function within the cell. Which type of RNA molecule is responsible for transporting amino acids during protein synthesis? Transfer RNA (tRNA) Ribosomal RNA (rRNA) Messenger RNA (mRNA) Small Nuclear RNA (snRNA) MicroRNA (miRNA) - correct answers ✅Transfer RNA (tRNA) What is the best way to store RNA for longer than a month? -In nuclease free (DEPC-treated) water, at -20°C or -80°C -In TrizolⓇ, at -20°C or -80°C -In Ethanol, at -20°C or -80°C -In DMSO, at -20°C or -80°C - correct answers ✅In Ethanol, at -20°C or -80°C How many hydrogen bonds are formed between one C:G base pair? 1 2 3 4 - correct answers ✅3 What is the enzyme responsible for stitching together Okazaki fragments? Helicase Single-stranded DNA binding protein Primase Ligase - correct answers ✅Ligase How is warfarin dosage affected in patients with VKORC1 deficiency? Patients receive a higher warfarin dose Patients receive a lower warfarin dose Warfarin dosage is unaffected - correct answers ✅Patients receive a lower warfarin dose When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them! Thermosequenase Helicase Primase Ligase - correct answers ✅Ligase In which of the following methods is the probe digested by the polymerase (Taq) during primer extension? Taqman FRET probes Molecular beacons Scorpion probes - correct answers ✅Taqman Which of the following is not a source of DNA damage? Chemical damage Splicing Attack by water -Immobilizing multiple unlabeled probes onto the membrane and allowing multiple unlabeled samples to hybridize to the unlabeled probes -Allowing a single labeled sample to hybridize to multiple labeled single stranded probes onto the membrane - correct answers ✅-Immobilizing multiple unlabeled probes onto the membrane and then allowing one labeled sample to hybridize to the unlabeled probes What signals the end of transcription? Stop codon Terminator The end of the DNA chain RNA polymerase runs out - correct answers ✅Terminator Which of the following is not a characteristic of eukaryotic DNA transcription? Multiple RNA polymerases TATA-binding protein Strict promoter sequences Transcription factors - correct answers ✅Strict promoter sequences What enzyme is crucial in the making RNA from DNA? DNA Polymerase RNA Polymerase Helicase Primase - correct answers ✅RNA Polymerase What is the predominant form of DNA? A Form B Form Z Form G Form - correct answers ✅B Form Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab? -To ensure that all equipment is being utilized to its full potential -To prevent amplified products from entering the post-PCR detection area of the laboratory -To avoid contamination of specimens with amplified product which create false positive results -To allow "dirty"(or infected) patient samples to become decontaminated before running an assay - correct answers ✅-To avoid contamination of specimens with amplified product which create false positive results In a retrovirus the RNA acts as: Genome and mRNA mRNA Genome rRNA - correct answers ✅Genome and mRNA Imagine you are working in specimen processing for the molecular laboratory and you receive a patient's specimen collected in a lavender top vacutainer tube containing EDTA. The test that is ordered requires that the specimen be collected in a yellow top ACD vacutainer tube. What is the BEST action to take in this instance? -Reject the specimen, inform the supervisor and request a new specimen drawn in ACD Labeling by random priming Labeling by nick translation End-labeling (using a terminal transferase enzyme) Labeling by hybrid capture - correct answers ✅Labeling by hybrid capture This enzyme is known for "unzipping" genes! Alkaline Phosphatase RNA polymerase Apyrase Helicase - correct answers ✅Helicase What volume of DNA (in microliters) is required to prepare a restriction digest that requires 10 µgs of DNA when the stock DNA is 5 µg/µl? 0.5 µl 1 µl 2 µl 5 µl - correct answers ✅2 µl Which one of the following complementary pairings is incorrect? A=T G=C U=T A=U - correct answers ✅U=T What is the advantage of Next Generation Sequencing (NGS) over traditional Sanger Sequencing? -Ability to sequence multiple mutation variants of a single gene at a single time -Preparation of a library -Easy setup -Use of a barcode reader - correct answers ✅Ability to sequence multiple mutation variants of a single gene at a single time What links codons and anti-codons together during DNA translation? DNA ligase Single-stranded binding protein Complementary base pairing GTP - correct answers ✅Complementary base pairing Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents combined have to pass down this affected gene to their child? 0% 25% 50% 75% 100% - correct answers ✅75% A cerebrospinal fluid (CSF) sample for hematologic evaluation should be tested within how many hours of collection? 1 hour 2 hours 3 hours 4 hours - correct answers ✅1 hour Blood drawn into what type of tube is compatible for Genetic testing?