(MB) ASCP PRACTICE EXAM QUESTIONS WITH ANSWERS LATEST 2023-2024 GRADED A+, Exams of Nursing

Download (MB) ASCP PRACTICE EXAM QUESTIONS WITH ANSWERS LATEST 2023-2024 GRADED A+ and more Exams Nursing in PDF only on Docsity!

(MB) ASCP PRACTICE EXAM

QUESTIONS WITH ANSWERS

LATEST 2023-

Exam Questions

Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base - correct answer Anti-codon

According to Chargaff's rule of base pairing, adenine pairs with: - correct answer Thymine

What genes would be screened in a breast cancer panel? - correct answer HER2, ERBB2, BRCA

Next Generation Sequencing uses: - correct answer Short sequence reads

Purines and pyrimidines differ from each other in that: - correct answer Purines have two rings; pyrimidines have one ring

The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine - correct answer Adenine and guanine

What is the rate of mutation per round of DNA replication? 1 in 1, base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs - correct answer 1 in 1,000,000,000 base pairs

The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the

molecule Nucleotide sequence of the molecule - correct answer Nucleotide sequence of the molecule

What are the phases in a qPCR Amplification Plot?Initiation, exponential, plateau

Baseline, exponential, plateau Baseline, threshold, exponential, plateau

Baseline, initiation, threshold, exponential, plateau - correct answer Initiation, exponential, plateau

Find the palindrome in this restriction enzyme site: 5'-CTGCAG-3'?5'-GAC 3'-GAC 3'-CTG 5'-GTC - correct answer 3'-GAC

A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient hasHuntington Disease, HD. Which of the following would be consistent with this diagnosis? 25 CAG repeats in the Huntington gene 85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene - correct answer 85 CAG repeats in the Huntington gene

Which two HPV types are responsible for most cases of cervical cancer? 16 and 18 31 and 59 16 and 58 44 and 59 - correct answer 16 and 18

Replication forks, known as origins of DNA replication, are created by this enzyme: Ligase Taq Polymerase Primase Helicase - correct answer Helicase

Mutation in what gene is associated with Fragile X syndrome? - correct answer FMR

Mantle cell lymphoma (MCL) is caused by what translocation? - correct answer t(11;14)

This polymerase is involved in "initiation of DNA replication and has primase activity": -correct answer Pol α

Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymeraseOkazaki fragments

Sanger fragments RNA fragments - correct answer Okazaki fragments

What gene is measured following treatment with imatinib (Gleevec)? FLT BCR/AblJak MAPK - correct answer BCR/Abl

What is the rate of mammalian DNA replication? nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second - correct answer 50 nucleotides per second

This polymerase is involved in "replicates mitochondrial DNA": - correct answer Pol γ

A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR - correct answer Standard PCR

Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC - correct answer -70ºC

Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous personfor gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp - correct answer m/+ = 350 bp; 250 bp; 100 bp

Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 75°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer - correct answer Increase the concentration of salt in the wash solution buffer

What enzyme is involved in LCR? - correct answer DNA LigaseNext Generation

Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization - correct answer Library preparation and extensive bioinformatics analysis

Which of the subunits of RNA polymerase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit - correct answer Sigma subunit

While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, confirming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y - correct answer 1691G>A

Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C - correct answer 58°C

This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol IRNA Pol II DNA Pol II - correct answer RNA Pol I

Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta- globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: - correct answer Pleiotrophy

What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR - correct answer NASBA

In what part of a qPCR Amplification Plot do you take your measurement? - correct answer Exponential phase

All of the following are liquid tumors, except:Mantle cell

lymphoma Ewing sarcoma Burkitt's lymphoma Acute promyelocytic leukemia - correct answer Ewing sarcoma

A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: - correct answer (2.545 * 50ng/mcl)= 127.

(127.25ng/mcl * 0.30) = 38.175ng/mcl

38.175ng/mcl ( 0.800mL1000) = 3054

micrograms

According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with: U or C A or G A, C or G Only A - correct answer A or G

This polymerase acts on DNA and produces Messenger RNA: - correct answer RNA Pol II

What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase - correct answer Qβ replicase

This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I - correct answer Type III

What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap Poly-A tail 5' Methionine Cap - correct answer 5' Methyl Cap

A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - correct answer 50%

The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA --> RNA --> Proteins DNA --

Proteins --> GenesRNA --> DNA - -> Proteins RNA --> Proteins --> DNA - correct answer DNA --> RNA --> Proteins

What drug is NOT metabolized by CYP2D6? Codeine OmeprazoleWarfarin Escitalopram - correct answer Warfarin

You have sequenced a gene and observe the following:

Reference: atgctggcacgacaggtttcccgactgg Sequenced:

atgCctggcacgacaggtttcccgactggThe mutation observed is

a:

Frame-shift mutation Insertion Silent mutation Non-conservative mutation - correct answer Frame-shift mutation

A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% - correct answer 100%

Which DNA polymerase is responsible for copying DNA by reading existing strand, building new complementary strand and always adds to 3' end, but can't start a new strand on its own (ORI sites)? DNA Polymerase IIIDNA Polymerase I Gyrase None of the choices listed - correct answer DNA Polymerase III

How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log 1log10 2log 3log10 - correct answer 0.5log

Which of the following is not a characteristic of a tRNA molecule? D arm Beta arm T arm Anti-codon arm - correct answer Beta arm

This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): - correct answer t(9;22)

What stain binds to minor groove of DNA Duplex? - correct answer SYBR

Which of the following best characterizes a vector? helps carry DNA into cell ie plasmids, virus allows formation of double-stranded moleculesinitiates replication during PCR decodes mRNA - correct answer helps carry DNA into cell ie plasmids, virus

Between which phosphate groups is the linkage between the GTP molecule and RNA chain in the 5' cap? Beta-beta Alpha- gammaGamma- beta Alpha-beta - correct answer Alpha-beta

This restriction enzyme "digests and removes a methyl group from Adenine": Type I Type II Type III DNase I - correct answer Type I

Primer dimers are due to what complimentary issue? 3' to 3' complementarity of primer pairs 3' to 5' complementarity of primer pairs 5' to 5' complementarity of primer pairs 5' to 3' complementarity of primer pairs - correct answer 3' to 3' complementarity of primer pairs

The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? C1' C2' C3' C4' - correct answer C3'

Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors that that can influence this process. G:C ratio of bases pH of the hybridization reaction Hybridization temperature All of the above - correct answer All of the above

A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: 76.35 micrograms/mL 3817.5 micrograms/mL 381.75 micrograms/mL

3054.0 micrograms/mL - correct answer 3817.5 micrograms/mL

Mutation in UGT1A1 affects metabolism of what drug? - correct answer Ironotecan

Testing for HOXB13, BRCA1 and BCRA2 is usually done in patients with: - correctanswer Prostate cancer

RT-PCR can be used to quantify messenger RNA (mRNA) among other uses. All of thefollowing concerning RT-PCR are true, EXCEPT: RT-PCR is useful in detecting RNA-viruses, such as HIV RT-PCR uses alkaline phosphatase to reverse amplify the signal RT-PCR produces cDNA using RNA templates - correct answer RT-PCR uses alkaline phosphatase to reverse amplify the signal

Southern blot can be used for all of the following purposes, except: Paternity testing Chromosomal staining Gene discovery and mapping Mutation analysis and identification - correct answer Chromosomal staining

If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer? A vegetarian diet Never having been pregnant Obesity Smoking - correct answer Smoking

Which of the following is not a common hydrogen bond acceptor? A carbonyl Primary amine Hydroxyl Tertiary amine - correct answer Primary amine

T-Cell Gene Rearrangement is seen in what malignancy?Sézary syndrome Burkitt's lymphoma Non-Hodgkin Lymphoma Polycythemia vera - correct answer Non-Hodgkin Lymphoma

The t(11;22) translocation is responsible for: - correct answer Ewing sarcomaIn CML, what

fusion protein is created?

EWS-FLI1 EWS- PAR

• BCR-Abl

c-myc-IGH - correct answer BCR-Abl

As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task?

Nested PCR Real- time PCR NASBA Multiplex PCR - correct answer Multiplex PCR

All of the following methods of amplification are considered target amplification, except:Quantitative PCR NASBA Strand Displacement Amplification Reverse Transcriptase PCR - correct answer NASBA

Which of the following reagents will successfully decontaminate a bench top that has been exposed to DNA amplification products? 70% Ethanol 5% Bleach 100% Isopropanol 10% Methanol - correct answer 5% Bleach

All of the following are components of nucleic acids, EXCEPT:Phosphate group Sugar (ribose or deoxyribose) Nitrogenous base (A, G, C, T) Formamide - correct answer Formamide

The amelogenin locus, found on the sex chromosomes, is used in gender identification. Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification were part of a gender identification procedure, what would be the gender of the individual? Male Female Hermaphrodite Can't be determined from the given information - correct answer Male

What assay amplifies the target using DNA polymerase?Branched DNA TMA

PCR NASBA

LCR - correct answer PCR

During DNA replication, the 3' -OH of the growing DNA chain attacks which phosphateof an incoming nucleotide? Alpha Beta Gamma Delta - correct answer Beta

What gene is measured following treatment with Warfarin?FLT VKORC1 MAPK P53 - correct answer VKORC

The process of making proteins is termed: Replication Translation Transcription Sequencing - correct answer Translation

How many polymorphisms can be found in the human genome? Approximately 10 million Approximately 100 thousand Approximately 1 billion Approximately 1 million - correct answer Approximately 10 million

This highly polymorphic loci region is crucial in assessing immune system compatibility:VNTRs HLA SINES SNPs - correct answer HLA

Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 5'-ATCTATGTCGGCAATT-3' 5'-TTAACGGCTGTATCTA-3' 5'-AATTGCCGACATAGAT-3' 5'-GAGCACGCTATCTTAT-3' - correct answer 5'-ATCTATGTCGGCAATT-3'

Mutations in the CFTR gene is associated with what disease? Fragile X Cystic Fibrosis Sickle- cell anemia

Mantle Cell Lymphoma - correct answer Cystic Fibrosis

The mother of a 3 year old boy took him to the doctor's office for concerns of an underlying genetic condition. A karyotype order was sent to the Molecular Diagnostic lab. Karyotype results show 47, XY,+21. Based on these results, the boy has: Patau Syndrome Down Syndrome Edward Syndrome Cri du chat Syndrome - correct answer Down Syndrome

In real-time PCR, what is amplified? The target The signal The probe All of the above - correct answer The target

When sequencing HLA-DR what is targeted? Exon 1 of the α subunit Exon 2 of the α subunit Exon 1 of the β subunit Exon 2 of the β subunit - correct answer Exon 2 of the β subunit

What is the rate of DNA translation? nucleotides per second 200 nucleotides per second 60 nucleotides per second 40 nucleotides per second - correct answer 60 nucleotides per second

This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target) of the PCR reaction: FRET probes Scorpion primers Molecular beacons Taqman - correct answer Molecular beacons

What is the most common mutation in Hemochromatosis? 1691G>A F508del R506Q C282Y - correct answer C282Y

Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy: Dystrophin P Musculin C-myc - correct answer Dystrophin

What is the sequence recognized by poly (A) polymerase? TATAAA CAA CCCGAA AAUAAA - correct answer AAUAAA

Splicing is the process that does which of the following? Remove exons and preserve introns Remove introns and preserve exons Remove mutated regions of primary transcript RNA (tRNA)? Add a poly-A tail to the end of a primary RNA transcript? - correct answer Remove introns and preserve exons

Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer)

-At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature. -When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored. - correct answer -At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature.

Acute promyelocytic leukemia (APL) is responsible for what translocation? - correct answer t(15;17)

What genes would be screened in a colorectal panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA1 KRAS, EGFR, ALK MSH2, PMS2, EPCAM - correct answer KRAS, BRAF, PIK3CA

What responds poorly to Ribavarin/Interferon treatment? HCV type 1 HCV type 2 HCV type 3 HCV type 4 HCV type 1 & 4 HCV type 2 & 3 - correct answer HCV type 1 & 4

If two parents are heterozygous for an autosomal recessive disease, then their offspring will most likely follow this gene frequency pattern:

-25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive -50% homozygous dominant, and 50% homozygous recessive -100% homozygous for the dominant phenotype -100% homozygous for the recessive phenotype - correct answer 25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive

This polymerase acts on DNA and produces Transfer RNA: RNA Pol II DNA Pol II RNA Pol III DNA Pol III - correct answer RNA Pol III

What assay is a signal amplification test and uses Alkaline Phosphatase?Branched DNA TMA PCR NASBA LCR - correct answer Branched DNA

What genes would be screened in a lung cancer panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA1 KRAS, EGFR, ALK MSH2, PMS2, EPCAM - correct answer KRAS, EGFR, ALK

Which of the following molecular methodologies would be the best for detecting a trinucleotide repeat disorder such as Huntington's disease?

Heteroduplex analysis Variable number tandem repeat analysis Single strand conformation polymorphism analysis Reverse-Transcriptase PCR - correct answer Variable number tandem repeat analysis

Which method would best be used to detect the Leiden mutation? PCR-RFLP bDNA amplificationPFGE Ribotyping - correct answer PCR-RFLP

Which of the following is not a step in the Southern blot procedure? DNA digest with restriction enzymes Gel resolution of fragments Fragments denaturation

Probe digest - correct answer Probe digest

Bone marrow transplantation is a great method used to treat several malignant and benign cancers, particularly leukemias. Before transplantation (or engraftment analysis), several polymorphic loci are screened in both the recipient and donor cells. The main goal of this screening is to:

-find at least one or more informative loci between both the donor and recipient -find exactly ten informative loci between both the donor and recipient -find all the non-informative loci between both the donor and recipient -find the blood type/group of both the donor and recipient - correct answer find at least one or more informative loci between both the donor and recipient

A DNA specimen was sent to your Molecular Diagnostics Laboratory for DNA sequencing, in order to determine whether patient A has a particular mutation in gene X. The gene sequence is known. However, the gene mutation itself is not known. Therefore, DNA sequencing cannot be performed on this DNA specimen. (True or False) True False - correct answer True

After an amplification procedure followed by gel electrophoresis, you took a photo of your gel. You notice consistent bands in all your gel lanes. However, you also see whatappears to be a faint but noticeable band in your reagent blank lane. What is your best explanation for the reagent blank band? -Taq polymerase concentration was too low in this PCR reaction -There was obvious contamination in this PCR reaction -The primers concentration was too high in this PCR reaction -The dNTPs concentration was too high in this PCR reaction - correct answer There was obvious contamination in this PCR reaction

In mantle cell lymphoma (MCL), this is the fusion gene created: EWS-FLI CCND1-IGH BCR-IGH c-myc-EWS - correct answer CCND1-IGH

This enzyme is known for "unzipping" genes! Alkaline Phosphatase RNA polymerase Apyrase Helicase - correct answer Helicase

Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 5'-ATCTATGTCGGCAATT-3'

5'-TTAACGGCTGTATCTA-3'

5'-AATTGCCGACATAGAT-3'

5'-GAGCACGCTATCTTAT-3' - correct answer 5'-ATCTATGTCGGCAATT-3'

What is the optimum storage condition for any specimen (whole blood, bone marrow, tissue etc.) awaiting RNA extraction? -Remove contaminating RBCs then immediately freeze at -20°C -Prepare a lyophilized cell pellet and store at room temperature -Refrigerate at 4°C indefinitely - correct answer Remove contaminating RBCs then immediately freeze at - 20°C

Which of the following is not a PCR step? Denaturation ElongationAnnealing Termination - correct answer Termination

Which PCR method has the highest specificity? qPCR Touchdown PCR Nested PCR Two-step PCR - correct answer Nested PCR

All of the following enzymes are part of the DNA replication machinery, EXCEPT: Ligase DNA polymerase Luciferase Helicase - correct answer Luciferase

What is the name of the molecule that is added to the 5' end of eukaryotic RNA transcripts? ATP SnRNP GTP Phosphate - correct answer GTP

What is multiplex PCR? -A PCR technique to amplify multiple targets -A PCR technique where a preamplified amplicon is amplified to increase sensitivity -A PCR technique where a preamplified amplicon is amplified to increase sensitivity A PCR technique that combines reverse transcription and amplification in one reaction -A PCR technique where various samples can be amplified in one reaction - correct answer A PCR technique to amplify multiple targets

Codons that code for the same amino acid are called: Synonyms

Similar Degenerates Complements - correct answer Synonyms

When comparing 2 samples in a qPCR Amplification plot, a log difference can be seenas approximately: ΔCt = 1 ΔCt = 3.3 ΔCt = 10 ΔCt = 6.6 - correct answer ΔCt = 3.

Deletion in the paternal chromosome 15: del(15)(q11q13) results in Prader-willi syndrome. However, deletion in the same region in the maternal chromosome results in a completely different condition known as Angelman syndrome. This phenomenon is an example of: Mosaicism Loss of heterozygosity Hemizygosity Genomic imprinting - correct answer Genomic imprinting

What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer? - correct answer t(18;X)

Testing for Aldehyde Dehydrogenase deficiency is important in patients with:Alcohol dependence Diabetis Lactic acidosis Obesity - correct answer Alcohol dependence

You could use all of the following methods to test for the the t(9;22) translocation,except: FISH Southern blot Reverse-transcriptase PCR Ribotyping - correct answer Ribotyping

The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? C1' C2' C3' C5' - correct answer C1'

Which of the following is not a mutation found in the HFE gene of hemochromatosis? C282Y H63D

5382insC S65C - correct answer 5382insC

Clinical laboratories must have clearly written protocols in place describing handling ofspecimens for clinical testing. Many factors can affect testing performance before the actual testing is conducted. Such factors or variables are collectively known as pre- analytical. From the list below, select all the pre- analytical variables that can have a negative impact on clinical testing (Hint: more than one answer choice!)

-Storage conditions -Patient identifiers -Anticoagulant in collection tubes -Transport procedures -Introduction of Heparin in all blood tubes to maintain specimen integrity for testing -Thermo cycling parameters -DNA isolation method used -Testing analysis software used - correct answer -Storage conditions -Patient identifiers -Anticoagulant in collection tubes -Transport procedures

What translocation is associated with Burkitt's lymphoma? - correct answer t(8;14)What does the

term consanguinity refer to? -The lines on a pedigree used to show relationships between siblings -The first affected family member coming to medical attention -The line of descent on a pedigree used to show relationships between parents and children -Individuals that share a common ancestor or are considered "of the same blood" -Neither of the listed choices - correct answer -Individuals that share a common ancestor or are considered "of the same blood"

There are many types of RNA molecules, each of which has a specific function within the cell. Which type of RNA molecule is responsible for transporting amino acids duringprotein synthesis? Transfer RNA (tRNA) Ribosomal RNA (rRNA) Messenger RNA (mRNA) Small Nuclear RNA (snRNA) MicroRNA (miRNA) - correct answer Transfer RNA (tRNA)

What is the best way to store RNA for longer than a month? -In nuclease free (DEPC-treated) water, at -20°C or -80°C -In TrizolⓇ, at -20°C or -80°C -In Ethanol, at -20°C or -80°C -In DMSO, at -20°C or -80°C - correct answer In Ethanol, at -20°C or -80°C

How many hydrogen bonds are formed between one C:G base pair? 1 2 3 4 - correct answer 3

What is the enzyme responsible for stitching together Okazaki fragments? Helicase Single-stranded DNA binding proteinPrimase Ligase - correct answer Ligase

How is warfarin dosage affected in patients with VKORC1 deficiency? Patients receive a higher warfarin dose Patients receive a lower warfarin dose Warfarin dosage is unaffected - correct answer Patients receive a lower warfarin dose

When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them! ThermosequenaseHelicase Primase Ligase - correct answer Ligase

In which of the following methods is the probe digested by the polymerase (Taq) duringprimer extension? Taqman FRET probes Molecular beacons Scorpion probes - correct answer Taqman

Which of the following is not a source of DNA damage? Chemical damage Splicing Attack by water Radiation damage - correct answer Splicing

All of the following are trinucleotide repeat disorders, EXCEPT:Spinocerebellar Ataxia Type 8 Huntington DiseaseAsperger Disease Fragile X Disease - correct answer Asperger Disease

This polymerase is involved in "short-patch base excision repair": Pol α

Pol β Pol γ Pol δ - correct answer Pol β

You have sequenced a gene and observe the following:Reference: atgctggcacgacaggtttcccgactgg

Sequenced: atgCTGctggcacgacaggtttcccgactggThe mutation

observed is a:

Frame-shift mutation Insertion Silent mutation Non-conservative mutation - correct answer Insertion

The 5' capping process creates what type of linkage? 5'-3' 3'-5' 5'-5' 3'-3' - correct answer 5'-5'

A reverse dot blot is best performed by: -Immobilizing multiple unlabeled probes onto the membrane and then allowing one labeled sample to hybridize to the unlabeled probes -Immobilizing one labeled probe onto the membrane and allowing multiple labeled samples to hybridize to the labeled probe -Immobilizing multiple unlabeled probes onto the membrane and allowing multipleunlabeled samples to hybridize to the unlabeled probes -Allowing a single labeled sample to hybridize to multiple labeled single stranded probesonto the membrane

• correct answer -Immobilizing multiple unlabeled probes onto the membrane and then allowing one labeled sample to hybridize to the unlabeled probes

What signals the end of transcription? Stop codon Terminator The end of the DNA chain RNA polymerase runs out - correct answer Terminator

Which of the following is not a characteristic of eukaryotic DNA transcription?Multiple RNA polymerases TATA-binding protein Strict promoter sequences

Transcription factors - correct answer Strict promoter sequencesWhat enzyme

is crucial in the making RNA from DNA?

DNA Polymerase RNA PolymeraseHelicase Primase - correct answer RNA Polymerase

What is the predominant form of DNA? A Form B Form Z Form G Form - correct answer B Form

Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab? -To ensure that all equipment is being utilized to its full potential -To prevent amplified products from entering the post-PCR detection area of thelaboratory -To avoid contamination of specimens with amplified product which create false positive results -To allow "dirty"(or infected) patient samples to become decontaminated before running an assay - correct answer -To avoid contamination of specimens with amplified product which create false positive results

In a retrovirus the RNA acts as:Genome and mRNA mRNA Genome rRNA - correct answer Genome and mRNA

Imagine you are working in specimen processing for the molecular laboratory and you receive a patient's specimen collected in a lavender top vacutainer tube containing EDTA. The test that is ordered requires that the specimen be collected in a yellow top ACD vacutainer tube. What is the BEST action to take in this instance? -Reject the specimen, inform the supervisor and request a new specimen drawn in ACD -Process the sample according to laboratory protocol because EDTA does not interferewith molecular testing methods -Document the tube additive change, process the sample, run the test, and hold the results until a supervisor or laboratory director signs off -Follow the prescribed laboratory protocol for accepting and rejecting specimens -Both B & D are correct -Both C & D are correct - correct answer -Follow the prescribed laboratory protocol for accepting and rejecting specimens

Which of the following is not involved in the splicing reaction? 5' splice site Hairpin loops Branch A point