Molecular Biology Techniques and Applications, Exams of Biology

Download Molecular Biology Techniques and Applications and more Exams Biology in PDF only on Docsity! 1 / 27 ASCP Molecular Biology Certification Exam Questions and Answers 1.Pyrimidine: One carbon ring Cytosine, Thymine, Uracil 2.Purine: Two carbon rings Adenine, Guanine 3.How are nucleotides joined together?: Condensation to form phosphodiester bond 4.What is the function of mRNA?: Carries genetic info out of nucleus Transcript translated to protein 5.What is the function of tRNA?: Carries aa to ribosome Anticodon pairs with codon on mRNA strand 6.What is the function of rRNA?: part of ribosome structure most abundant RNA coordinated coupling of tRNA to mRNA codons 7.Feedback inhibition: Product of pathway is noncompetitive inhibitor Binds to allosteric site to slow down rxn b/c too much product 8.Exonucleases: Degrades nucleic acids by removing one terminal nt at a time Cleaves phosphodiester bond at end of chain 2 / 27 5' --> 3' and 3' --> 5' 9.Endonucleases (Prok): Restriction enzymes Cleaves phoshpodiester bonds w/i poly-nt chain Recognition site is palindromic sequence Types I-V 10.ORI sites: nt sequence where replication is initiated 11.Topoisomerase I: Induces ss breaks Remove DNA supercoils during TXN and DNA replication; for strand breakage during recombination; for chr condensation; and to disentangle intertwined DNA during mitosis 12.topoisomerase II: cuts both strands of one DNA double helix, passes another unbroken DNA helix through it, and then reanneals the cut strands 13.Gyrase (topoisomerase II): Unwinds supercoiling caused by unwinding at the rep fork by introducing DSBs 14.Helicase: Breaks H-bonds of double helix at the replication fork 15.Primase: DNApol ±D( NA dep RNA pol) adds short segments of complementary RNA to ssDNA template (primers), serves as starting points for replication 16.single-strand DNA binding proteins (SSBPs): Binds ssDNA and prevents it from re-annealing during TXN, replication, repair, and recombination 17.Okazaki fragments: Short fragments of DNA synthesized by DNApol ´using the 5 / 27 DNA: 5' --> 3' transcription: 3' --> 5' DNA --> RNA (promoter) translation: 5' --> 3' mRNA 36.Spectrophotometer: Measures amount of light absorbed Quantitative measurement of [DNA/RNA] 37.At what wavelength does DNA and RNA absorb?: 260 nm 38.At what wavelength does protein absorb?: 280 nm 39.Organic isolation method: 1. Lyse 2.Add phenol/ chloroform > vortex/spin 3.Transfer aqueous layer (top) to new tube 4.Add chloroform:IAA (removes phenol) > vortex/spin 5.Transfer aqueous layer to new tube 6.Add NaOAc and EtOH > vortex/spin 7.Decant 8.Resuspend 40.How do you inactivate RNases?: 200C for 2 hrs 30 min in 1M NaOH or quanidinum isothiocyanate 41.Hybridization: 2 ssDNA molecules of comp base sequence can form a ds hybrid (duplex) 42.What does the incubation step in hybridization do?: Allows formation of ds 6 / 27 molecules 43.Blocking DNA (Hybridization): minimizes probe binding to nonspecific se- quence ie salmon sperm DNA, Human LINE-1 44.Blocking Proteins (Hybridization): minimize nonspecific binding of probe to membrane ie casein (milk), Denhardt's sol 45.Stringency: conditions of hybridization that control the specificity of binding of the probe to the target sequence 46.How can you increase strigency in a hybridization?: decrease [salt] increase [formamide] increase temp 47.Formamide acts as a in a hybridization.: denaturing agent 48.Line Probe Assay (LiPA): reverse hybridization assay using sequence-specific oligonucleotide probes (reverse SSOP) multi-parameter testing --> single strip 49.Line Probe Assay steps: 1. Isolate nucleic acid (RNA) 2.Amplify 3.Hybridization 4.Strigent wash 5. Incubate with conjugate 7 / 27 6. Incubate with substrate 7.Detect 50.What method would you use if you knew the gene sequence and the mutation?: Reverse Dot Blot 51.Microarrays: Used for unknown gene and mutation cDNA libraries can be used for gene expression, tumors, genetic mapping, mutations and polymor- phism large scale, high throughput analysis 52.Microarray steps: 1. isolate mRNA from cells 2.RT to get labeled cDNA copies of mRNA 3.cDNA washed over slide. cDNA sticks to comp sequence 4.use laser to read fluorescent tags 53.Southern Blot: Detect a large DNA fragment among many Target: DNA, probe: DNA 54.What can Southern Blots be used to detect?: Deletions/insertions Point mutations Polymorphisms Structural rearrangements 55.Southern Blot steps: 1. RE digest to fragment DNA 10 / good for small DNA fragments high buffering capacity decreases migration thru gel 63.Pulse Field Gel Electrophoresis steps: 1. culture 2.embed pellet in agarose plug 3.treat w/ lysozyme (cell lysis) 4.proteinase K 5.gel 64.How can Tween 20 affect PCR?: Stabilizes Taq Suppress formation of 2* structures Increase yield Increase non-specific amplification 65.What are some disadvantages of PCR?: Must know the sequence first Prone to contamination May not be 100% specific Specificity dependent on temp and [Mg] 66.What is the purpose of primers in PCR?: to intiate replication 67.What are the 3 steps of PCR and their temperatures?: Denature 90-96C Anneal 50-70C Extension 68-75C 11 / 68.PCR process: 1. Prep MMx: buffer, taq, primers, dNTPs 2.Add target 3.Place in thermocycler 4.Denature dsDNA 5.Anneal: allows primers to hyb 6.Extend: pol adds dNTPs to 3' 7.Repeat steps 4-6 69.What can cause primer dimers?: annealing temp too low too much primer 70.What are primer dimers?: Size is sum of two primers Primers hyb and are extended by Taq 71.What can inhibit PCR amplification?: Detergent (SDS) Phenol (left over from DNA isolation) Heparin (specimen tube) Heme Dyes CSF, urine, sputum, parafilm 72.What is the use of uracil-N-glycosylase (UNG) in PCR?: Prevents contami- nation by destroying amplicons containing dUTPs 73.What are some causes of too many bands on a gel after PCR?: Primers not 12 / specific Annealing temp too low Too many cycles Too much Mg++ 74.RT-PCR: RNA --> cDNA first strand synthesis 75.Bisulfite DNA sequencing/Methylation specific: 1. RE digest 2.Electrophorese and purify fragment of interest 3.Denature and incubate w/ sodium bisulfate (turns C>U, methylated C is un- changed) 4.clean, ppt, and resuspend 5.PCR --> sequence 6.Compare treated vs untreated, note where CG are not changed to TA 76.How does PCR work with methylated DNA?: primers are designed to recog- nize methylated and unmethylated sense strands at gene promoter the methylated bases inhibit enzyme activity at recognition sites 77.Ligase Chain Reaction (LCR): Probe amplification Two adjacent primers are ligated and amplified by a 2nd set of primers if mutation is present at 3' end of upstream primer Can detect a 1 bp mis-match 78.Which pathogens can LCR be used to detect?: Chlamydia 15 / 88.Why does Sanger sequencing use ddNTPs instead of dNTPs?: ddNTPs lack of a 3' OH which makes it impossible for pol to add more nucleotides --> chain termination 89.ddNTP: dideoxyribonucleoside triphosphate lack a hydroxyl group (OH) at 2' and 3' 90.Fluorescent in situ hybridization (FISH): Uses fluorescent probes to detect DNA sequences on chr 91.What are some of the benifits of FISH?: Large number of cells may be scored Dual color --> multiple targets Many sample types 92.What types of probes are used for FISH?: Dual fusion: 2 probes flank the breakpoint at both t locations CEN probes: centromeric probes bind to repetitive alpha satellite sequences Telomeric probes Whole chr paints 93.What is the wavelength for background in spectrophotometery?: 320 nm 94. How do you determine quality of DNA/RNA using a spectrophotometer?: - A260/A280 95. What is considered good quality DNA/RNA from spectrophotometry?: - DNA: 1.7-2.0 RNA: 2.0-2.3 16 / 96.What is considered poor quality RNA/DNA from spectrophotometry?: <1.7 Protein contamination 97.What does smearing on a gel indicate?: Sample degradation Loaded too much 98.How can you tell if you have good RNA using gel electrophoresis?: Good RNA will have a 2:1 intensity (28S : 18S) if 18S is more, RNA degradation is possible 99.What is one way you can increase the yield/quality of DNA/RNA after running gel?: Do an EtOH ppt 100. Which specimen tubes are the best for use with molecular assay?: EDTA (lavender/purple) ACD (yellow) 101. Which specimen tubes are not good for use with molecular assays?: He- parin (brown/green) inhibits several enzymes used in molecular assays 102. Should you freeze blood or bone marrow if you are going to use it in a molecular assay?: NO Room temp 22-25C Neutrophils will degranulate if frozen 103. What is the best temperature to store DNA?: Long term = -70C 17 / short term = -20C 104. For long term storage, what should you store DNA in?: TE or DNase free H2O 105. What is the best temperature to store RNA?: Long term = -70C short term = -20C 106. Should you lyse RBCs before freezing?: YES 107. After an extraction/isolation, what should you elute with?: DNA - TE or water RNA - DEPC water 108. What are the two types of isolation/extraction methods?: Liquid phase (organic & inorganic) Solid phase (Qiagen) 109. What some causes of DNA damage?: mutagens carcinogens cell death age-related decreases in DNA repair genetic disease 110. Nucleotide Excision repair (NER): Done by endonucleases Removes a span of nt's by cleaving phosphodiester bond 111. Base Excision repair (BER): Done by DNA glycosylase, AP endonuclease Cleaves glycosidic bond of a single base base, leaving apurinic/apyrimidinc site 20 / 132. Haploid: Single copy of each chr (humans have 23) 133. Diploid: Two copies of each chr (humans have 46) 134. DNA polymerase: Catalyzes phosphodiester bond between nt's Uses ssDNA as a template to determine which nt's to add 135. DNA Polymerase I (Prok): Processes Okazaki fragments Replaces RNA primers with DNA (exonuclease activity) Excision repair & proof reading 136. DNA Polymerase II (Prok): DNA repair, exonuclease activity 137. DNA Polymerase III (Prok): Primary enzyme involved in replication Exonuclease activity 138. DNA Polymerase IV (Prok): Bypass replication SOS response 139. DNA Polymerase V (Prok): Bypass replication SOS response Translesion synthesis DNA repair 140. DNA Polymerase ±E( uk): Primase DNA dependent DNA & RNA pol 141. DNA Polymerase ² (Euk): Base excision repair (BER) 142. DNA Polymerase ´ (Euk): Lagging strand synthesis DNA repair, exonuclease, replaces primers as it encounters Okazaki fragments 21 / 143. DNA Polymerase µE( uk): Leading strand synthesis exonuclease 144. DNA Polymerase ³ (Euk): mtDNA replication and repair Exonuclease activity 145. Terminal transferase: DNApol synthesizes poly-nt chain at 3' end w/o a tem- plate 146. Transcription: initiation --> elongation --> termination 147. Retrotransposons: Mobile genetic elements which can increase genome size and insert itself within coding/noncoding regions 148. The three biochemical activities of reverse transcription: RNA-dependent DNApol, Ribonuclease H, and DNA-dependent DNApol --> all used to create ds cDNA from RNA 149. Describe the steps of reverse transctiption: 1. tRNA acts as a primer and hybridizes to virus genome 2.Complementary DNA then binds to the U5 (non-coding region) and R region 3.RNAse H degrades the 5' end of the RNA which removes the U5 and R region. 4.The primer then "jumps" to the 3' end of the viral genome and the newly synthe- sized DNA strands hybrid 150. Exons: Gene sequences that represent codons used in TLN to protein 151. Introns: Non-coding sequences that are spliced out before TLN 22 / 152. Splicing: modification of the nascent pre-messenger RNA (pre-mRNA) tran- script in which introns are removed and exons are joined. 25 / 8.Hyb with probe 170. SyBr green: Non-specific intercalation into the minor groove of dsDNA, can be used in qPCR 171. Chaotropic agents: disrupts the structure and denatures the DNA by increas- ing the entropy and non-covalent forces like hydrogen bonds (ex. chemicals like - sodium iodide, or sodium perchlorate) 172. TaqMan: Relies on the 5' exonuclease cleavage activity of Taq pol to cleave a dual labeled probe during hybridization to the complementary target sequence. Only emits a signal once separated from quencher. 173. FRET probes: Fluorescence Resonance energy transfer - Distance dependent interaction between the electronic excited states of two dye molecules in which excitation is transferred from a donor molecule to an acceptor molecule without emission of a photon. 174. Molecular beacons: Measures accumulation of product at the annealing step Contains target specific seq and inverted repeat that forms stem-loop At annealing step probe hyb's to target, separating R and Q 175. Scorpion probes: PCR prod is covalently bound to dye; primer is bound to molc beacon type seq After extension, target specific seq will unfold w/ the newly synthesized target seq, separating R and Q 26 / 176. Components of PCR: DNA template Two primers that are complementary to the 3' Taq polymerase dNTPs Buffer solution Mg2+ (divalent cations) - higher Mn2+ concentration can increase the error rate during DNA synthesis 177. Thermal Cycling steps in conventional PCR: 1. Initialization (94-96 C) 2.Denaturation (94-98 C) 3.Annealing (50-65 C) 4.Extension (70-80 C) 5.Repeat 2-4 ~30x 6.Final Elongation (70-74 C) 6. Final hold 178. Optimization of PCR methods: 1. Check the Tm 2.Mg2+ concentration - too little can result in no PCR product, and too much may produce noise 3.PCR cycles 4.Add, extend, or increase the temp of the initial template denaturation step 27 / 5.Concentrations of other buffer components 6.GC Content 179. Real-Time PCR/qPCR: PCR based method which is used to amplify and quantify a targeted DNA molecule. Enables both detection and quantification. The quantity can be either an absolute number of copies or a relative amount when noramalized to the DNA input. 180. PCR DNA Array: DNA array is a collection of spots attached to a solid support (such as a microscope slide) where each spot contains one or more ssDNA oligo fragments. Arrays make it possible to put down large quantities of very small spots on a single slide. Each spot has a DNA fragment that is complementary to a single DNA sequence. 181. Reverse Transcriptase PCR: Used to detect RNA expression levels. RT-PCR is used to qualitatively detect gene expression through creation cDNA transcripts from RNA. 182. Branched DNA Technololgy (bDNA): used for DNA or RNA; short probes are used to capture the target nucleic acid and then to multiple reporter molecules, loading the target nucleic acid with signal. 183. Sequence Based Nucleic Acid Amplification (NASBA): Used to amplify RNA sequences; Primer-dependent technology that can be used for the continuous amplification of nucleic acids in a single mixture at one temperature; works at 41 C 30 / ions that are released during the polymerization of DNA as opposed to the optical methods. A microwell containing a template DNA is flooded with a single type of nucleotide (A,T,G,C) and if the nucleotide is complementary to the template it is incorporated into the growing strand of DNA. This causes the release of hydrogen ions that triggers the sensor. 193. SOLiD Sequencing (NextGen): Sequencing by ligation. A pool of all possible oligonucleotides of a fixed length are labeled according to the sequenced position. The oligonucleotides are annealed and ligated, the preferential ligation by DNA ligase for matching sequences results in a signal informative of the nucleotide at that position. Before sequencing, the DNA is amplified by emulsion PCR and the resulting beads (each containing single copies of the same DNA) are deposited on the glass slide for sequencing. 194. Dye terminator: ddNTPs are used and fluorescently labeled instead of the primer. All four reactions are performed in the same tube. Terminated nucleotides are amplified. 195. Dye primer: Four different fluorescent dyes are added to the primers. Cycling is done to attach the primer and that is what the instrument sees. Each nucleotide is amplified a different color. 196. Too many and too few ddNTPs result in:: too many ddNTPS will result in many short sequence reads, too little will result in loss of sequencing data but will give a longer read. 31 / 197. Pyrosequencing: No gels, fluorescent dyes, sequencing ladder, or ddNTPS; Pyrophosphate (PPi) is released when the phosphodiester bond forms between the dNTP and the primer and is converted to ATP. The ATP then generates a luminescent signal by luciferase-catalysed conversion of luciferin to oxyluciferin. This is repeated with each of the nucleotides - the generation of a signal indicates which nucleotide is the correct base in the sequence. GTTAC (dG peak, dT peak (double that of dG), dA peak, dC peak. Most useful for short to moderate sequencing analysis, or SNPs. Used in HLA 198. Maxam-Gilbert Sequencing: Differing concentrations of salt are used in four different tubes - A, T, C, G - Usually DMS (dimethylsulphate), FA (formic acid), H (hydrazine), and H+S (hydrazine + salt) --> read on a gel 199. Bisulfate DNA sequencing: A type of chain termination sequencing designed to detect methylated nucleotides. Methylation of cytosine residues in DNA is an important part of gene regulation and expression - this is important for detecting different types of cancer. During the incubation C is converted to U and 5-methylated C is unchanged. A PCR reaction is then performed using normal chain termination methods. 200. Denaturing High-performance Liquid Chromatography (HPLC): Analysis for PCR products 150-450 bp. The heteroduplexes elute ahead of the homoduplexes as the conditions intensify. The migrating homoduplexes are detected by absorbance at 260nm or fluorescence. 32 / 201. Melt Curve Analysis: Used for SNPs; Specimens with identical sequences should yield the same peak at the expected Tm and specimens containing different sequences will yield two or more peaks. (FRET Probes - dissociation curves) 202. Nucleic Acid labeling: Common labels used to generate nucleic acid probes include radioactive phosphates, biotin, fluorophores and enzymes. In addition, the bioconjugation methods used for nucleic acid probe generation may be adapted for attaching nucleic acids to other molecules or surfaces to facilitate targeted delivery or immobilization, respectively. 203. In-situ hybridization: Used to detect protein, RNA, and DNA within the cell. Probes bind to the DNA and can be visualized under the microscope. Depending on the mutation, different signals can be seen - deletions and duplications. Sensitivity can be increased by using dual fusion probes, break apart probes, centromeric probes, and telomeric probes. 204. Dual fusion probes: Uses two pairs of probes with different fluor dye Bind regions that span the breakpoint of both t partners If t is present, signal from both dyes should be present 205. Break apart probes: Bind to the chr flanking the t breakpoint region WT will emit a combination signal (next to each other) and t will emit separated signals. 206. Centromeric probes (CEN): designed to hybridize to the high alpha 35 / community. It is the world's largest association composed exclusively of board- certified pathologists and pathologists in training and is the worldwide leader in laboratory quality assurance. The College advocates accountable, high-quality, and cost-effective patient care. 217. CMS: Previously known as the Health Care Financing Administration (HCFA), is a federal agency within the United States Department of Health and Human Ser- vices (DHHS) that administers the Medicare program and works in partnership with state governments to administer Medicaid, the State Children's Health Insurance Program (SCHIP), and health insurance portability standards. In addition to these programs, CMS has other responsibilities, including the administrative simplification standards from the Health Insurance Portability and Accountability Act of 1996 (HIPAA), quality standards in long-term care facilities (more commonly referred to as nursing homes) through its survey and certification process, and clinical laboratory quality standards under the Clinical Laboratory Improvement Amendments. 218. CLSI: Clinical Laboratory and Standards Institute; A not-for-profit membership organization, the Clinical and Laboratory Standards Institute (CLSI) brings together the global laboratory community for a common cause: fostering excellence in lab- oratory medicine. We do so by facilitating a unique process of developing clinical laboratory testing standards based on input from and consensus among industry, government, and health care professionals. 36 / 219. FDA: FDA is responsible for protecting the public health by assuring the safety, efficacy and security of human and veterinary drugs, biological products, medical devices, our nation's food supply, cosmetics, and products that emit radiation. also responsible for advancing the public health by helping to speed innovations that make medicines more effective, safer, and more affordable and by helping the public get the accurate, science-based information they need to use medicines and foods to maintain and improve their health. 220. Methylation of cytosine bases 5' to the gene will increase or decrease expression?: decrease 221. Histone acetylation close to the gene will increase or decrease expres- sion?: increase 222. siRNAs complementary to the gene transcript will increase or decrease expression?: decrease 223. Calculate the DNA concentration from the following: 260=0.172 (D.F. 1:100): 860 ug/mL = .172 abs * 50 ug/mL * 100 DF 224. [DNA] = 1535 ug/mL. You have 0.5 mL. What is the total yield.: 767.5 ug = 1535 ug/mL * 0.5mL 225. [DNA] = 767.5 ug/mL. You have 0.5 mL What is the total yield.: 383.75 ug = 767.5 ug/mL * 0.5 mL 226. [DNA] = 860 ug/mL. You have 0.5 mL. What is the total yield.: 430 ug = 860 ug/mL * 0.5mL 37 / 227. Calculate the RNA concentration from the following: 260=0.307 (DF 1:100): 1228 ug/mL = 0.307 abs * 40 ug/mL * 100 DF 228. An RNA preparation has the following readings: 260=0.208 280=0.096 Is this RNA suitable for use?: Yes, 2.17 is suitable for RNA analysis A260/A280 = 0.208/0.096 229. How does PFGE separate larger fragments more efficiently than standard electrophoresis?: Repeated reorientation forces larger fragments through the gel matrix more efficiently 230. If fragments are dissolved in 50% formamide will the stringency be higher or lower?: Higher 231. If fragments are dissolved in a high concentration of NaCl will the strin- gency be higher or lower?: Lower 232. Does heating a solution from 65C to 75C during hybridization raise or lower stringency?: raises 233. What would the autoradiogram show if the stringency was to high?: no bands 234. Calculate the Tm of the following primers: Forward: GGAGCTTTGTTTCAACCAAG Reverse: ATTAAATGCGGAATTGCCCA: Forward: Tm=(4C x 9GC)+(2C x 11AT) = 58C 40 / e.g. Von Willebrand's dz, hemophilia, Factor V Leiden 251. Factor V Leiden: 1q25, F5 gene 1691G>A, R506Q Causes deep vein thrombosis Treated with anticoagulants (warfarin/Coumadin) 252. Prothrombin: G20210A A bleeding disorder that slows the blood clotting process. Mutations in the FII gene cause prothrombin deficiency. 253. Methylenetetrahydrofolate reductase: 1p36.3, MTHFR gene; C677T (A222V), A1298C (E429A) Methylenetetrahydrofolate reductase catalyzes conversion of MTHF--> 5-MTHF which is converted to Met Thromboembolism, homocysteine builds up, Met is depleted 254. Fragile X syndrome: Xq27 FMR1, CGG repeat 5' UTR causes methylation Mental retardation WT repeats 5-55, carrier 56-200, mutation 200- 2000+ Dx: PCR, S. blot for full mutation 255. Huntington disease (HD): 4p16.3 HD/HTT; CAG repeat CAG repeat in HD/HTT causes multiple Q's at 5' of Huntingtin protein. Protein aggregates in plaques (especially in nervous tissue) slowing down brain function; symptoms appear at 30+ yo; impaired judgement, slurred speech, difficulty swal- lowing, intoxicated appearance 41 / WT repeats 9-37, HD 38-86 repeats Dx: PCR, S.blot to resolve full mut 256. Muscular dystrophy (DMD/BMD): Xp21, dystrophin gene; XR Causes muscle weakness and muscle loss DMD: non-functional protein made BMD: some function of protein is retained 257. Cystic fibrosis (CF): 7q31.2 CFTR gene; F508del; AR Cl channel membrane protein Affects cells that produce mucus, sweat, saliva, and digestive juices; causes thick secretions Dx: RFLP, PCR-RFLP, HD, Invader, SSP-PCR 258. Gaucher's disease: 1q21 GBA; AR N370S or L444P Lipid, glucosylceramide, accumulates in WBCs, liver, spleen, lungs, bone marrow and, less commonly, brain, caused by a deficiency of the enzyme glucocerebrosi- dase, which helps the body process the fatty substance glucocerebroside. Dx: PCR ->seq coding region 259. Hereditary hemochromatosis: 6p21.3 HFE; C282Y, G>A; AR a genetic disease that causes the body to absorb and store too much iron Treatment: phlebotomy 260. Prader-Will syndrome: del(15)(q11q13) paternal; maternal is 42 / imprinted Congenital dz, mental retardation, short stature, obesity, hypogonadism 261. Angelman syndrome: del(15)(q11q13) maternal; paternal is imprinted Ataxia, seizures, inappropriate laughter 262. Histocompatibility: A state or condition in which the absence of immunolog- ical interference permits the grafting of tissue or the transfusion of blood without rejection. 263. Trastuzumab (Herceptin): Treats Her2/Neu/ErbB2+ (17q12 over expression) breast cancer. mAb binds extracellular domain of EGFR receptors, blocking mitogen binding 264. Warfarin (Coumadin): Anticoagulant, prevents thrombosis thromboembolism VCORC1: -Group 1: fast metabolizers/high dose -Group 2: slow metabolizers/low dose CYP2C9: SNPs cause slow metabolism/low dose 265. Clopidogrel (Plavix): Antiplatelet agent Activated by CYP2C19 CYP2C19 poor metabolizers at high risk of treatment failure, death, heart attack, and stroke 266. Carbemazepine (Tegretol): Treat bipolar disorder, seizures, neuropathic pain Dangerous/fatel skin rxns w/ HLA alleles: 45 / Imatinib (Gleevec) 274. Chronic lymphoid leukemia (CLL): del(17)(p913) TP53 del(11)(q22) ATM del(13q) long arm clonal b-call malignancy, progressive accumulation of mature lymphocytes Most common leukemia Dx: Flow cytometry; 'basket' or 'smudge' lymphocytes Treatment: chemo., BM transplant 275. Endonucleases (Euk): Cleaves phoshpodiester bonds w/i poly-nt chain DNase I: induces DSBs AP endonuclease: BER 276. Tay Sachs disease: 15q, HEXA gene; AR 1278insTATC, exon 11 Insufficient hexoaminidase A activity; GM2-gangliosides cannot be broken down and accumulate in the brain; causes cerbral degeneration and blindness 277. A-DNA conformation: Right-handed Deep narrow major groove, wide shallow minor groove Dehydrated DNA takes this form 278. B-DNA conformation: Right- handed Wide major groove, narrow minor groove Common form found in cells 46 / 279. Z-DNA conformation: Left-handed caused by stress or torsion (e.g. during transcription) 280. Human papillomavirus (HPV): Types 16 and 18 cause most cervical cancers 281. Major histocompatibility complex (MHC): Group of genes located on 6p MHC gene products are called human leukocyte antigens (HLA) 282. HLA class I: HLA-A, HLA-B, HLA- C Expressed on all nucleated cells Composed of an ±and ²-2chain (Domains:±1, ±2, ±3) Polymorphisms located on chr 6, exon 2 and 3 283. HLA class II: HLA-DP, HLA-DQ, HLA- DR Expressed on Ag presenting cells Composed of an ± (±1 & ±a2n)d ² (²1 & ²2) Polymorphisms located on chr 6, exon 2 284. HLA class III: Complement C2, C4, B Expressed on plasma proteins 285. Graft versus host disease (GVHD): Donor cells recognize host (recipient) cells as foreign and attack and destroy 286. Multiplex Ligation-dependent Probe Amplification (MLPA): Probe amplifi- cation; multiple targets amplified in a single rxn 2 oligos: both contain sequence specific probe and universal primer 47 / Oligos hybridize adjacent to each other > ligase closes gap > PCR with primers that are specific to universal primer sites on the oligos 287. Histone acetylation and deacetylation: Lysine (K) residue on N-termini Acetylation = active, removes + charge Deacetylation = inactive Euchromatin 288. Histone methylation: Lysine (K) and arginine (R) can be methylated Common on K residues of H3 and H4 tails Methylated = silenced Heterochromatin 289. Complement-dependent cytotoxicity test (CDC): Receipient alleles deter- mined by using a panel of Ab against known HLA types Cross-reactive: leukocyte being tested has Ag matching Ab in well 290. Crossmatching: CDC is used to crossmatch potential donor and recipient Recipient serum is the source of Ab tested against donor lymphocytes 291. Mixed leukocyte culture (MLC): Determines T-cell cross-reactivity donor and recipient lymphocytes are mixed in culture; the degree of incompatibility is indicated by the number of cells that have undergone transformation and mitosis, or by the uptake of radioactive isotope-labeled thymidine. 50 / 4.EtOH ppt 5.Resuspend 303. Solid phase isolation: 1. Lyse 2.Acidify (low pH) 3.Transfer to column (adsorption) 4.Wash 5.Elute 304. What is SDA used to detect?: Mycobacterium tuberculosis Chlamydia trachomatis 305. What is bDNA used to detect?: HIV Hepatitis 306. Interphase FISH: Used to study prenatal samples, tumors, and hematological malignancies Cells do not have to be cultured Fix cells Hyb to probe (dual fusion, break-apart, CEN, telomere) 307. Metaphase FISH: Used to study smaller abnormalities Culture cells for 72 hrs Add colcemid to arrest cells in metaphase Fix Hyb to probe (chr paint) 51 / 308. Hazard label: Blue: Health hazard Red: Fire hazard Yellow: Reactivity White: specific hazard 0 no hazard - 4 severe hazard 309. Pharmocogenomics: The study of genetic factors that influence how a drug works. The goal is to understand how a person's genotype affects an individual's response to drugs. It deals with the influence of genetic variation on drug response in patients by correlating gene expression or snp's with a drug's efficacy or toxicity 310. Drug metabolism: Several genes are responsible for variances in drug metab- olism and response, CYP450 is the most well known 52 / CYP metabolism phenotypes: extensive metabolizer (EM), intermediate, ultra-rapid, and poor 311. Irinotecan: Prevents DNA from unwinding by inhibition of topoisomerase 1 Inactivated by glucuronidation to uridine diphosphate glucoronosyltransferase 1A1 (UGT1A1) 312. Tamoxifen: Treats ER+ breast cancer ER antagonist Metabolized by CYP2D6 and 3A4 to its active form 313. Gefitinib (Iressa): Treats EGFR+ (Her1, Her2) breast cancer Tyr kinase antagonist Metabolized by CYP3A4 to its active form 314. Nucleosome: 147 bp of DNA wrapped around histone octamer plus a H1 linker 315. Human genome: 2.9 billion bp ~30k - 40k genes 46 chr, diploid 316. Breast cancer, Her1/ErbB1: EGFR, estrogen receptor (ER), is overexpressed Estrogen binds, ER dimerizes -> TXN of genes that promote