Download Protein Synthesis: Nucleic Acids, Transcription, and Translation and more Exams Advanced Education in PDF only on Docsity!
Bio Beyond - Making Proteins
Where are the "instructions" for cellular function stored? Nucleic acids Let's review - what are some functions of nucleic acids? Store information Speed up reactions Transport information Shown is a diagram of a single-stranded DNA segment, similar to the one you built in Genetic Blueprints, along with the three components of a single nucleotide. Match the components to their names and determine the sequence of the complementary strand, using single letters for the bases. Base Sugar Phosphate Complementary sequence from bottom to top (enter letters only - no spaces or punctuation): ATCG What holds the two strands together? Hydrogen bonds
Where do you think the information is encoded? The sequence/order of bases Produces free proteins Ribosome E Yes Protects genetic material nucleus A no Produces proteins to be excreted Endoplasmic Reticulum B No
Transcription is guided by the same interaction that guides DNA replication: base pairing. What do you recall are the normal base pairs in DNA? Select all that apply. A-T C-G An adenine (A) in DNA bonds with in RNA. A cytosine (C) in DNA bonds with in RNA. A guanine (G) in DNA bonds with in RNA. A thymine (T) in DNA bonds with in RNA. U G C A RNA is made, or synthesized, by RNA polymerase, an enzyme that copies information from DNA to a new mRNA strand very much like DNA polymerase does when DNA is copied. To copy the information, RNA polymerase has to be able to read the information on a single strand of DNA. Thinking about how DNA is normally stored in cells, what has to be done to the DNA before messenger RNA can be made? Select all that apply. It has to be unwound The hydrogen bonds between bases have to be broken Just transcribe from left to right. UUAGCGGCUUAUGGCUAAUGUGGCC
You have seen that DNA is double-stranded, but only one strand is used to make mRNA. Which of the following is the most likely reason the second strand is evolutionarily conserved? The second strand provides stability and redundancy for DNA How many different possibilities are there for a single base in mRNA? It may help to write them out using the single letter codes above. 4 Are there enough possibilities to make the 20 different amino acid combinations using a single base? no What if mRNA used a group of two bases to store the information? How many different possibilities are there for a group of two bases in mRNA? It may help to write them out using the single letter codes above. For example, a pair of bases could be AA, AU, AG, AC, and so forth. 16 Are there enough possibilities to make the 20 different amino acid combinations using two bases? no As you saw in the previous screen, one and two base combinations don't provide enough variation to account for the 20 amino acids observed. The table below will help you determine how many combinations are possible for three bases. Fill in each combination below.
UAC
Using what you see in the animation, put the steps of translation in order below. Drag the amino acids into the correct sequence to translate the 15-base mRNA strand below into a polypeptide. Scroll through the list of amino acids to view all possibilities. DNA Template: 3' - TAC CCA AAT ATA CGC GGA TTA TCA TAA ACT - 5' AUG GGU UUA UAU GCG CCU AAU AGU AUU UGA Translate the mRNA sequence into a polypeptide by dragging the appropriate amino acids into the area below. What do you notice about each polypeptide? They are all folded into complex shapes How many polypeptides do you see in hemoglobin 4 However, in humans, there are hundreds of thousands of proteins but only about 20,000 genes. What does this mean? Some genes encode multiple proteins
What do you see happening in the animation on the right? The mRNA was cut and put back together How might this allow for the large number of proteins compared to native genes? The organism can produce multiple proteins from the same original mRNA
