Previous Lecture:
Working with images
Today’s Lecture:
Characters and strings
Brief introduction to recursion—more later
Announcements:
Section will be in the classrooms this week
Project 4 posted. Due Tues 3/31 at 11pm.
Prepare for your exams
Study with the several resources on Docsity
Earn points to download
Earn points by helping other students or get them with a premium plan
Guidelines and tips
Prepare for your exams
Study with the several resources on Docsity
Earn points to download
Earn points by helping other students or get them with a premium plan
Characters and Strings, Introduction to Recursion | CS 1112, Study notes of Computer Science
Material Type: Notes; Class: Introduction to Computing Using MATLAB; Subject: Computer Science; University: Cornell University; Term: Spring 2009;
Typology: Study notes
Pre 2010
1 / 28
This page cannot be seen from the preview
Don't miss anything!
Related documents
Partial preview of the text
Download Characters and Strings, Introduction to Recursion | CS 1112 and more Study notes Computer Science in PDF only on Docsity!
^ Previous Lecture:^ ^ Working with images ^ Today’s Lecture:^ ^ Characters and strings^ ^ Brief introduction to recursion—more later ^ Announcements:^ ^ Section will be in the classrooms this week^ ^ Project 4 posted. Due Tues 3/31 at 11pm.
March 24, 2009^
Lecture 17^
Characters & strings ^ We have used strings already:^ ^ n= input(‘Next number: ’)^ ^ sprintf(‘Answer is %d’, ans) ^ A string is made up of individual characters, so astring is a 1-d array of characters ^ ‘ CS
rocks!
’ is a character array of length
13; it has 7 letters, 4 digits, 1 space, and 1symbol.
C^ S^ 1 11 2
r^ o^ c^ k^ s^!
March 24, 2009^
Lecture 17^
Numerical data is often encoded in strings. E.g., a filecontaining Ithaca weather data begins with the string
W07629N
meaning
Longitude:
o^76 29’ West Latitude:
o^ 26’ North
We may need to grab hold of the substring
W
convert
^076 and
^29 to the numeric values 76 and 29, and
Strings are important in computationdo some computation
March 24, 2009^
Lecture 17^
Comparison of genomic sequences is another example ofstring computation ^ E.g., looking for a pattern:Given the sequence
ATTCTGACCTCGATC…
Look for the pattern
ACCT
^ E.g., quantifying the difference betweensequences:
ATTCTGACCTCGATCATTCGTGACCTCGAT
What if this nucleotide is removed?
March 24, 2009^
Lecture 17^
Some useful string functions str= ‘Cs 1112’;length(str)
% 7 isletter(str)
% [1 1 0 0 0 0 0] isspace(str)
% [0 0 1 0 0 0 0] lower(str)
% ‘cs 1112’ upper(str)
% ‘CS 1112’ ischar(str)% Is str a char array? True (1)strcmp(str(1:2),‘cs’)% Compare strings str(1:2) & ‘cs’. False (0)strcmp(str(1:3),‘CS’)% False (0)
Example: capitalize 1
st^ letter
Write a function to capitalize the first letter of each wordin a string. Assume that the string has lower case lettersand blanks only.function [str, nCaps] = caps(str)% Post: Capitalize first letter of each word.%^ str = partially capitalized string%^ nCaps = no. of capital letters% Pre: str = string with lower case letters & blanks only
look for the spacesLook For The Spaces
March 24, 2009^
Lecture 17^
Character vs ASCII code str=
‘Age
%a^ 1-d
array
of^
characters
code=
double(str)%convert
chars
to^
ascii
values
str1=
char(code)%convert
ascii
values
to^
chars
March 24, 2009^
Lecture 17^
Arithmetic and relational ops on characters ^ ‘c’-‘a’
gives 2
^ ‘6’-‘5’
gives 1
^ letter1=‘e’;
letter2=‘f’;
^ letter1-letter
gives -
^ ‘c’>’a’
gives true
^ letter1==letter
gives false
^ ‘A’
+^2
gives 67
^ char(‘A’+2)
gives ‘C’
March 24, 2009^
Lecture 17^
What is in variable g (if it gets created)? d1=^
‘Mar
d2=
‘Mar
x1=^
d1(5:6);
x2=
d2(5:6);
g=^ x2-x1;^ A: the string ‘
B: the number 16C: Error in the subtraction operationD: Error in assigning variables
x1 ,^ x
E: Some other value or error
March 24, 2009^
Lecture 17^
Example: toUpperWrite a function toUpper(cha) to convert character cha toupper case if cha is a lower case letter. Return theconverted letter. If cha is not a lower case letter, simplyreturn the character cha.Hint: Think about the distance between a letter and thebase letter ‘a’ (or ‘A’). E.g.,
a b c d e f g h …A B C D E F G H … Of course, do not use Matlab’s function upper!
distance
= ‘g’-‘a’ = 6 = ‘G’-‘A’
March 24, 2009^
Lecture 17^
Example: removing all occurrences of a character ^ Can solve this problem using iteration—check onecharacter (one component of the vector) at a time ^ New strategy:
recursion ^ Possible when result can be accumulated iteratively ^ E.g., remove all the blanks in string sSame as remove blank in s(1)
and remove blanks in s(2:length(s)) ^ E.g., capitalize first letter of all words in a sentence ^ Same as capitalize 1
st^ letter of first word and capitalize 1
st^ letter of the rest of the words
March 24, 2009^
Lecture 17^
function s = removeChar(c, s)% Return string s with character c removedif length(s)==
% Base case: nothing to do returnelse end
March 24, 2009^
Lecture 17^
function s = removeChar(c, s)% Return string s with character c removedif length(s)==
% Base case: nothing to do returnelseif s(1)~=c% return string is% s(1) and remaining s with char c removedelse endend
March 24, 2009^
Lecture 17^
function s = removeChar(c, s)% Return string s with character c removedif length(s)==
% Base case: nothing to do returnelseif s(1)~=c% return string is% s(1) and remaining s with char c removedelse% return string is just% the remaining s with char c removedendend