Genetics Exam Review, Study notes of Genetics

This document is an Exam review for Exam 1 in genetics.

Typology: Study notes

2022/2023

Uploaded on 02/11/2026

kareem-el-giar
kareem-el-giar 🇺🇸

1 document

1 / 24

Toggle sidebar

This page cannot be seen from the preview

Don't miss anything!

bg1
Adjacent nucleotides on the same strand of a DNA molecule are held together by what kind
of bonds?
A. Peptide bonds
B. Phosphodiester bonds
C. Hydrogen bonds
D. Deoxyribophosphodiester bonds
E. Ionic interactions
RNA nucleotides differ from DNA nucleotides in that RNA nucleotides have a….
A. OH group at the 5’ carbon
B. OH group at the 3 carbon
C. OH group at the 2’ carbon
D. H group at the 2’ carbon
E. -OH group at the 4’ carbon
In the Hershey-Chase blender experiment, if 35S was detected inside the bacteria and next
generation of phages, we would have to conclude…
A. DNA is the genetic material
B. RNA is the genetic material
C. Protein is the genetic material
D. Sulfur is the genetic material
E. Carbohydrate is the genetic material
If a double-stranded DNA molecule is 22% G, what percent of the bases is A?
A. 22%
B. 44%
C. 11%
D. 28%
E. 56%
You plan to heat a collection of DNA samples with known sequences to separate the two
strands. Which of the following samples will require the most amount of heat to separate?
A. AAAAA TTTTTTT
B. A TTAGCTTGGTC
C. GGGCTTTTCCTA
D. CCTA TA TTAGGG
E. GGCCGAAA TTTT
If, hypothetically, RNA is the genetic material in the pneumococcal bacteria used in Avery,
McLeod, and McCarty’s transformation experiment, which of the following would be true
about their results:
A. DNase treatment would abolish transformation activity of the S bacteria extract.
B. RNase treatment would enhance the transformation activity of the S bacteria
extract.C. RNase treatment would abolish the transformation activity of the S bacteria
extract.
D. Protease treatment would abolish the transformation activity of the S bacteria
extract.
E. Protease treatment would enhance the transformation activity of the S bacteria
extract.
7. What observations were crucial in allowing Watson and Crick to propose the double helix
1
·
Between
Nucleotides
2
.
&
DNA
=
1
+
2
S
RNA
=
OH
2/
S
/
3
.
G
35S
=
Dectect
protein
-
3)
p
:
Dectect
DNA
=
4
.
-
A
-
T
=
56/
:
/2
=
28
G
-
C
22
22
%
100
-
44
=
56
%
5
-
Least
nect
blc
A-T
G
-
C
blc
-
%
they
have
3
hydrogen
bonds
6
.
In
the
experiment
-
showed
DNA
is
the
transformin)
principle
bic
only
DNase
destroyed
tranformati
-
pf3
pf4
pf5
pf8
pf9
pfa
pfd
pfe
pff
pf12
pf13
pf14
pf15
pf16
pf17
pf18

Partial preview of the text

Download Genetics Exam Review and more Study notes Genetics in PDF only on Docsity!

Adjacent nucleotides on the same strand of a DNA molecule are held together by what kind of bonds? A. Peptide bonds B. Phosphodiester bonds C. Hydrogen bonds D. Deoxyribophosphodiester bonds E. Ionic interactions RNA nucleotides differ from DNA nucleotides in that RNA nucleotides have a…. A. – OH group at the 5’ carbon B. – OH group at the 3’ carbon C. – OH group at the 2’ carbon D. – H group at the 2’ carbon E. - OH group at the 4’ carbon In the Hershey-Chase blender experiment, if 35 S was detected inside the bacteria and next generation of phages, we would have to conclude… A. DNA is the genetic material B. RNA is the genetic material C. Protein is the genetic material D. Sulfur is the genetic material E. Carbohydrate is the genetic material If a double-stranded DNA molecule is 22% G, what percent of the bases is A? A. 22% B. 44% C. 11% D. 28% E. 56% You plan to heat a collection of DNA samples with known sequences to separate the two strands. Which of the following samples will require the most amount of heat to separate? A. AAAAA TTTTTTT B. A TTAGCTTGGTC C. GGGCTTTTCCTA D. CCTA TA TTAGGG E. GGCCGAAA TTTT If, hypothetically, RNA is the genetic material in the pneumococcal bacteria used in Avery, McLeod, and McCarty’s transformation experiment, which of the following would be true about their results: A. DNase treatment would abolish transformation activity of the S bacteria extract. B. RNase treatment would enhance the transformation activity of the S bacteria extract.C. RNase treatment would abolish the transformation activity of the S bacteria extract. D. Protease treatment would abolish the transformation activity of the S bacteria extract. E. Protease treatment would enhance the transformation activity of the S bacteria extract.

  1. What observations were crucial in allowing Watson and Crick to propose the double helix 1 · (^) Between (^) Nucleotides

& (^) DNA = 1 + 2 S RNA^ =^ OH^ 2/ S /

3. G

35S=^ Dectect (^) protein

  1. (^) p : Dectect (^) DNA = (^4). (^) -

A -^ T^ =^ 56/: /2 = 28

G -^ C 22 22 % 100 -^44 =^56 % 5 Least nect blc A-T^ - G -^ C^ blc

% they have^3 hydrogen bonds

  1. (^) - In^ the^ experiment showed (^) DNA is (^) the transformin) (^) principle bic

only DNase

destroyed (^) tranformati

structure of DNA? A. Chargraff’s rule of the relative frequency of different nucleotides and Franklin’s X-ray diffraction of a DNA molecule. B. Griffiths’ observation of a transforming factor. C. Hershey and Chase’s demonstration of DNA as a genetic material. D. The determination of the genetic code by Nirenberg and Khorana. E. All of the above.

  1. A DNA-binding protein recognizes a specific sequence of nucleotide bases. Which region in the double-helical structure of DNA would it most likely binding and “recognize” the sequence? A. 5’ end. B. 3’ end C. Minor groove D. Major groove E. Intermediate groove
  2. In the Meselson and Stahl experiment, what would their results have looked like after one generation of DNA replication if, hypothetically, the mode of replication is conservative? A. Only light band B. Only heavy band C. Only half heavy (intermediatband D. One half heavy and one light band E. One heavy and one light band
  3. Which of the following strands will require constant priming during DNA replication? A. The leading strand B. The lagging strand C. The sense strand D. Both A and B E. None of the above
  4. Which of the following statements regarding the origin of replication in E. coli, oriC, is/are true? A. B. C. It is a DNA sequence. It is bound by the DnaA protein. Binding of DnaA causes the strands in the G-C rich sequence to separate.D. Two of the above E. All of the above
  5. DNA ligase is commonly found on which strand during replication? A. The leading strand B. The lagging strand C. The sense strand D. Both A and B E. None of the above
  6. DNA synthesis (addition of nucleotides) during replication proceeds in which direction? A. 5’ to 3’ B. 3’ to 5’ C. Either direction D. Depends on which strand showed (^) peredity transferins : (^) In (^1952) , afterwards After (^) watson (^) and Crick : (^) has more structures to (^) identify

One (^) parental 2 One (^) Daughter S$ : (^) continuous : (^) discontinuous , Oskaki strand.

· :^ Uri^ is^ defined^ DNA (^) sequence on the Ecoli (^) chromosome

B.^ :^ DnaA binds specific (^) repeats in oric to initate (^) replication C. Y LEA-T

: (^) Already continuous

  • > The (^) Lagging strand (^) is (^) synthesized : RNA discontinuously in^ short Transcription (^) fragments called^ Okazaki (^) fragments : DNALigase is (^) needed to Join (seal) the (^) sugar phosphate (^) backbone (^) blu these fragements, forming a continuous (^) strands. : NO : (^) DNA (^) Synthesis is (^) always (^) S't 3 : (^) both (^) are (^) s' (^) to 3

is read from 5’ to 3’. E. None. All of the above statements are true.

  1. In Rho-dependent termination… A. Rho binds to the operator and represses transcription. B. Rho binds to the rut site on the coding strand. C. Rho binds to the rut site on the template strand. D. Rho binds to the rut site on the mRNA. E. Rho binds to galactosides and regulates the lac operon.
  2. Rho-dependent and Rho-independent transcriptional termination have which of the following in common? A. They both involve rut sites. B. They both involve release factors. C. They both use stem-loop structures formed in the RNA to stop or pause transcription. D. They both do not require proteins for termination. E. They both depend on the 3’ to 5’ exonuclease activity of RNA polymerase.
  3. The splicing reactions require the breaking and re-making of … A. peptide bonds. B. disulfide bonds. C. phosphodiester bonds.D. glycosidic bonds. E. james bonds.
  4. How would you experimentally demonstrate that Group I and Group II self-splicing introns do not require proteins? A. By adding DNase B. By adding Protease C. By adding RNase D. By adding extra proteins E. By adding extra RNA
  5. The nucleotide sequence in the resulting RNA transcript is complementary to the sequence in which strand of the gene? A. Template strand B. Coding strand C. Sense strand D. Leading strand E. Lagging strand
  6. If the genetic code is made of two-base codons, how many different amino acids at most can be encoded by such a code? (Hint: a one-base codon can code for only 4 different amino acids. Also don’t worry about start and stop codons, for now.) A. 64 B. 4 C. 16 D. 20 E. 8
  7. The wobble hypothesis… 26'toS/ : this^ describes^ repressor^ protein : It binds^ to^ RNA^ Transcript^ not DNA (^). : The^ rNArut^ towardsite^ is a^ sequence (^) on (^) the nascent MRNA wher Rho^ binds^ alon RNA (^) polymerase (^) to terminate transcriptur : Describing lac (^) repressor and inducer system Only Rho-dependent^ termination : this^ is translation termination Both (^) rely on RNA (^) secondary structures Chairpins).^ RHO-Indepdent s^ caused t A (^) poly to stop. Do depended^ assist^ in^ Pausing RNA. : (^) only Rho-dependent. : (^) NO : Link amino^ acids^ in^ proteins : Stabilize protein.
  • link^ the^ sugar^ to^ the^ base^.
  • > (^) Doesn't (^) exist · Degra · Cadet (^) if proteins are^ necessar (^) a A : RNA^ polymerase the^ template^ strand^3 to^ S^ &^ Synthesis^ RNA^ complementary^ to^ 5 to 3 : same as^ RNA^ Transcript^ ;^ RNA^ not^ complementary^. > A ,^ v.^ G^ ,^ C 4x4 =^16

A. addresses degeneracy in the third base of some codons. B. explains why different codons code for the same amino acid. C. is partly explained by the presence of the inosine base in the anticodons. D. Two of the above. E. All of the above.

  1. The wild-type mRNA has the following sequence in the middle of the transcript/coding region: GUGGCCGGACUUUUUGCC. Which of the following are possible amino acids encoded by this sequence (use the Genetic Code table included in the exam)? A. …Trp, Pro, Asp, Phe, Leu, Pro… B. …V al, Ala, Gly, Leu, Phe, Ala… C. …Gly, Arg, Thr, Phe, Cys… D. All of the above. E. None of the above.
  2. An important enzymatic protein isolated from Drosophila melanogaster was shown to have the following initial sequence of amino acids: Wildtype: Lys - Ser - Pro - Trp - His -..... . Following exposure to x-rays, a series of mutant flies developed, each of which lacked normal activity for this enzyme. One of the mutant enzymes was isolated and displayed the following amino acid sequence: Mutant: Lys – Arg – Pro – Trp – His - ...... What is the likely mutation which led to the observed amino acid sequence for the mutant (use the Genetic Code table included in the exam)? A. A base was deleted between the second and third codons. B. Substitution of the third base in the second codon. C. Nonsense mutation was introduced. D. Substitution of the second base in the second codon. E. An extra base was inserted between the second and third codons.
  3. In the Nirenberg and Leder experiment to identify which charged tRNA binds to which codon in the ribosome, what should have been the result when they added the RNA with one the stop codon sequences? A. The initiator tRNA charged with methionine is bound to the ribosome. B. The tRNA charged with the release factor is bound. C. The terminator tRNA charged with glycine is bound. D. The terminator tRNA charged with phenylalanine is bound. E. No tRNA is bound to the ribosome.
  4. All incoming tRNAs bind to the A site of the ribosome with the exception of … A. the terminator tRNA. B. the initiator tRNA. C. the arginine-tRNA. D. all of the above. E. none of the above. All tRNAs enter at the A site.
  5. Which of the following are responsible for the alignment of the start codon in the P site of the ribosome in bacteria? A. Elongation factors B. The Shine-Dalgarno sequence C. The 16 S rRNA D. Rho protein E. Two of the above yes yes NO - www (^) - Askins for (^) possible amino If we shift one base UGG (^) CCG (^) , GAC acids (^6) Val (^) , ALA^ , Gly , Le0^ , Phe : (^) shifting by two (^) bases (^) GG G (^) - O O

S (^) Ser (^) AGU

& Arg^ AG / -

/ They tested^ to^ see^ which only Start binds not^ AUGstop tRNA binds + o a (^) ribosome Not tRNAS When (^) a specific (^) codon is

7. NO

present. stop codons^ do^ not^ have tRNAS (^) recognize them and^ are recognized (^) by release^ factors : recognized by release^ Mnemonic

  • (^) actor #^ I start in p site^ , the^ rest : The^ initation^ +RN^ binds Enters at^ the^ P-site^ enter^ the^ A^ site* : (^) Enter A-si + (^) e directly^ to^ the^ P-site^ ,^ all subsequent (^) incoming (^) amimacyl-tRNES enter (^) the A site befor (^) peptide bond (^) formation : (^) These after (^) initiation (^) , (^) during elongation ,^ not^ start^ codon (^) a (^) lignment : (^) Durine rich sequence (^) , mRNA (^) upstream (^) of the start cadon that (^) base-pairs with the 3' (^) end of ISNURNA : the 16RS^ RNA (^) of the 305 binds^ Shino-Dalgno (^) positioning the (^) ribosome correctly : involved in^ transcription^ termination, not (^) translation. Shine-Dalgarno +^ 16SrRNA^ =^ Start^ codon^ Alignment
  1. Imagine that you are working in a lab studying the SARS-CoV-2 virus and you are trying to do an Avery-McLeod-McCarty type experiment to determine the genetic material of this virus. Y ou know that if you transduce a mixture of macromolecules from viral isolates (taken from human nasal swabs) into human cultured cells, new infectious viral particles are made. Y ou perform three experiments: 1. Y ou treat the mixture with protease, then you observe that new viral particles are synthesized. 2. Y ou treat the mixture with RNase and observe that no new viral particles are synthesized. 3. Y ou treat the mixture with DNase and observe that new viral particles are synthesized. How do you interpret these results? A. SARS-CoV-2 uses DNA as its genetic material. B. The SARS-CoV-2 virus uses RNA as its genetic material. C. The SARS-CoV-2 virus uses both proteins and DNA as its genetic material. D. There was likely an error in the experiment because DNase treatment should have had the opposite result. E. Avery, McLeod and McCarty tried this with SARS-CoV-2 and obtained different Results.
  2. How many of these molecules depicted in the figure below could be used to make a primer during DNA replication? A. 6 B. 5 C. 3 D. 4
  3. The building blocks of DNA are called _________. A. amino acids B. codons C. alleles D. nucleotides
  4. Which of the following attaches adjacent Okazaki fragments, forming a continuous DNA strand? A. DNA ligase B. DNA polymerase I C. DNA polymerase III D. Topoisomerase E. DNA primase
    1. Protease^ virus^ still made Protein not^ genetic
    2. Rase^ - >^ NO^ new^ virus^ made LRNA is required
    3. (^) DNaso - > (^) new virus DNA is^ not^ required Only RNA^ is^ needed^ ;^ removing RNA prevent viral replication : removes^ RNA^ primers^ I replaces with^ DNT : (^) sunthesizes most^ of^ the^ new^ DNA : (^) releives supercoiling ahead of the replication^ fork : (^) synthesizes RNA primers
  1. The fact that the helixes of the DNA strand are arranged in opposite directions gives DNA its characteristics.

A. antiparallel B. water-soluble C. redundant D. complementary

  1. Which of the following statements regarding DNA synthesis at the ends of linear chromosomes is true? A. DNA synthesis at the ends of linear chromosomes is a problem also observed in prokaryotic cells. B. C. Cancer in humans is associated with a reduction in the activity of telomerase. Because DNA polymerase is not able to initiate strand synthesis, linear chromosomes will have a 3' overhang at their ends. This is corrected by telomerase, an enzyme composed of both RNA and protein, which extends the ends of eukaryotic chromosomes. D. Telomerase, an enzyme composed of both RNA and protein, functions by cleaving the 3' overhangs that are left by DNA polymerase. E. Because DNA polymerase has proofreading capabilities, replication at the ends of linear chromosomes is usually error-free, and telomerase, an enzyme composed of both RNA and protein, simply ensures that any incorporated errors are corrected.
  2. In eukaryotes, enhancers must be close to the promoter to have an effect. A. true B. false
  3. The purpose of DNA replication is to produce __________. A. two parental strands B. two daughter strands C. two template strands D. None of these choices are correct.
  4. How does DNA differ from RNA? A. RNA contains different sized phosphate groups. B. RNA uses only purines. C. RNA has multiple bases attached to the sugar. D. RNA uses a different five-carbon sugar.
  5. A DNA strand can be described as antiparallel but uncomplementary. A. True B. false
  6. Which base is not found in DNA? A. Guanine B. Cytosine C. Thymidine D. Uracil E. Adenine S' (^3) S 2 Essential^ top base (^) pairins

: (^) Prokaryotic have^ circular^ chromosome

- Ribose

RNA : DNA :^ Deoxyribose DNA :^ ATG[ Rua =^ AUG C

RNA pol III - tRNA and 5s rRNA D. RNA pol I - mRNA RNA pol II - tRNA and 5s rRNA RNA pol III - rRNA

  1. Adenine and thymine form__________ hydrogen bonds between them, while cytosine and guanine form__________ hydrogen bonds. A. 3; B. 2; C. 4; D. 3;
  2. How many hydrogen bonds would exist between the bases in a DNA molecule with one strand of the sequence GGCA TA T? A. 34 B. 17 C. 14 D. 7 E. 21
  3. Which of the following best describes the double-helix of DNA? A. It has directionality B. All of these choices are correct C. The strands are complementary D. The strands are arranged in an anti-parallel arrangement
  4. α-helices and β-sheets are examples of what level of protein structure? A. Amino acid pairing B. Secondary structure C. Primary structure D. Quaternary structure E. Tertiary structure
  5. The C-terminus of a polypeptide always contains __________. A. a stop codon B. an amino group C. carbon dioxide D. a carboxyl group E. None of these choices are correct.
  6. You are charged with the task of expressing a protein in bacteria that will be used to treat a disease in humans. This will require the expression of the desired protein and then its purification from bacteria. What is a suitable strategy to efficiently express and purify the protein of interest? A. Create a chimeric gene that has the coding sequences of the desired protein fused to the gene of a protein that is easily isolated. B. Add a methionine codon into the middle of the coding sequence of the gene of interest so that you can follow its synthesis with radioactive methionine that is added to the growth media. C. Clone the gene so that it is under the control of the Beta-gal promoter. D. Add several codons to the end of the gene of interest to increase its mass. A - T =^2 E-C (^3)

3332222 =^8 +^9 = (

G-^ C^ =^3 A - T =^2 : Sequence : Multiple chains : Full 3-D structure : (^) is found (^) in (^) the MRNA : N : + erminus : (^) N/A : (^) always ends with^ a^ Carboxyl^ C-COOH)^ group. Describes (^) purfication (^) tas Not (^) help with (^) purfication only address I Durfication Doesnot mean (^) purfication

  1. A certain strain of Neurospora crassa (bread mold) was found to not grow on minimal medium, but could grow on minimal medium supplemented with arginine. Which of the following statements is a reasonable hypothesis to explain this observation of this strain of Neurospora? A. The strain likely makes too much arginine to survive on minimal medium. B. The strain likely has a mutation in a gene encoding an enzyme required for the arginine biosynthetic pathway. C. The observation indicates that wild-type Neurospora likely require the addition of arginine to their growth medium in order to survive. D. The strain likely does not express the enzyme required to convert arginine to Another necessary compound. E. The strain likely has a mutation in one of the chemical intermediate molecules in the arginine biosynthesis pathway.
  2. The wild-type eye color of Drosophila is red. A single-base mutation can occur that produces a white eye color. What statement is correct regarding this mutation? A. It is an example of a mutation that likely alters protein function. B. It is an example of a neutral mutation. C. It is an example of a silent mutation. D. White eye color is the wild-type. E. Individuals with white eyes have a reversion mutation.
  3. An experimenter constructed a merozygous strain of E. coli that had the chromosomal genotype for the lac operon LacI+, P+, O-, ZY A+, and this strain also had an F' genotype of LacI-, P+, O+, ZY A+. P stands for the promoter, O stands for the operator, and ZY A stands for the structural genes of the operon. The + indicates a wild-type sequence, while - indicates that the sequence is mutant. What do you predict to be the expression of beta-galactosidase from the lac operon? A. Expression of beta-galactosidase will never be observed in the presence of lactose. B. C. D. Expression of beta-galactosidase will be constitutive. Expression of beta-galactosidase will be observed in the presence of lactose only. Expression of beta-galactosidase will be both constitutive and regulated by lactose. E. Expression of beta-galactosidase will only be observed in the presence of both lactose and glucose.
  4. If a bacteria is placed in an environment that contains both glucose and lactose, the regulation of the lac operon will allow which nutrient to be processed first? A. Both will be processed equally B. Lactose C. Neither will be processed in this environment D. Glucose B/C the^ strain^ cannot (^) grow on (^) minimal medium but can (^) grown (^) when (^) an is provided. Suggest it Adding more^ wouldn't^ cannot^ sunthesize help On^ its^ own : Altered^ the^ gene^ that^ affects^ pigement productic Not neutral red-white : (^) Silent muxations don't change amino (^) acids No ↓ S La Cl^ +:^ repressor^ protein^ that bind to^ wild (^) type

· operator^ Sequence

(0 (^) +) P +^ functional repressor Protein O-Leis (^) acting) :^ cannot bind only ZA += (^) beta-g is produced : Lactose (^) is (^) only used after (^) glucose is depleted · bacterial (^) prefers (^) glucose first

  1. Which repair mechanism is responsible for repairing damage from UV light? A. Mismatch repair B. Nucleotide excision repair C. Base excision repair D. Nonhomologous end joining (NHEJ) E. Recombinational repair
  2. Which repair mechanism often leads to deletions in chromosomes? A. Base excision repair B. Nonhomologous end joining (NHEJ) C. Nucleotide excision repair D. Mismatch repair E. Recombinational repair
  3. Which repair mechanism identifies daughter strands by methylation? A. Nucleotide excision repair B. Direct repair C. Base excision repair D. Mismatch repair E. Nonhomologous end joining (NHEJ)
  4. Consider the following DNA sequence, which codes for the first portion of a long protein beginning at the A TG (AUG in mRNA) start codon. 5' A TG CCC CGC AGT AGG GGG TGG AGA3' A mutation occurs changing this sequence to: 5' A TG CCC CGC AGT AGG GGG TGA AGA3' What type of mutation is this? (Choose the answer that completely characterizes this change) A. Transition mutation, point mutation, nonsense mutation. B. Transition mutation, frameshift mutation. C. Point mutation, missense mutation, transition mutation. D. Silent mutation, Point mutation E. Transversion mutation, point mutation, missense mutation.
  5. How many promoters are in an operon? A. The number is determined by the sigma factors. B. 1 C. 3 D. 2 E. It depends on how many genes are present in the operon
  6. The genetic code is nearly universal in nuclear DNA from bacteria to mammals. A. true B. false
  7. A deletion in an operon removes the promoter. How will that affect the transcript that is produced from the operon? A. The transcript will be produced, but longer than normal B. The transcript will not be produced C. The transcript will produced, but will contain a deletion D. The transcript will be produced and normal in length : (^) correct replication errors : removes (^) a short sesement^ of^ DNA^ containing (^). the damage. : (^) Repair Small ,^ nor^ helix (^) distorting lesions Repairs double-strand breaks Double (^) strand (^) break (^) repair. : (^) repairs double stranded in (^) DNA by (^) directly ligatingthe broken (^) ends (^) together. Error (^) prone (^) ,Leads to deletion. Mismatch correct^ error^ that escape (^) proofreading during
    • & NA (^) replication. (^) In prokaryote the (^) parental template is (^) methlayted , so the repair can find (^) the daughter. O Point :^ Only I^ base^ change Nonsense :^ London is now^ a^ stop^ codon O Transition : mu from (^) G to A changes to^ a^ stop^ codon Not missense^ :^ not^ a^ different Amino (^) kids frameshift (^) : (^) nothing inserted or deleted Silent :^ Not (^) changing the (^) protein.

E. The transcript will be produced, but shorter than normal

  1. A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it? A. Proline B. Glycine C. Alanine D. None of these choices is correct. E. Arginine
    1. The template strand of a gene has the sequence 5' CCTCTAGAAAGGCCCAACGGAAGAAGTAAGCCA T 3'. What is the sixth encoded amino acid in the polypeptide? A. Tyr B. Met C. Arg D. Phe E. Trp
    1. In the lac operon, the operator is an example of a trans-effect genetic regulation. A. true B. False
  2. In bacterial inducible gene regulation, a small molecule inducer binds to a repressor and… A. prevents it from binding to DNA. B. helps it bind to DNA. C. inhibits gene transcription. D. prevents RNA polymerase from binding to the promoter. E. increases its binding to cAMP.
  3. Which of the following is NOT a mechanism of gene regulation in bacteria? A. Regulatory proteins can bind to DNA and decrease transcription. B. Proteins or RNAs can bind to mRNA and prevent translation. C. Modifications of their protein products can alter their functions. D. Regulatory proteins can bind to DNA and increase transcription. E. 5’ capping of RNA can regulate their stability and translation.
  4. For a repressible gene in bacteria, the binding of a small molecule corepressor to a repressor… A. prevents it from binding to DNA. B. helps it bind to DNA. C. inhibits gene transcription. D. prevents RNA polymerase from binding to the promoter. E. increases its binding to cAMP (*this should have been Two of the above).
  5. What type of molecule is the lac repressor? A. DNA B. RNA C. Protein D. Sugar E. Lipid MRNA3'CCG51 * (^) S'GCC 31 - (^6) I CGV Transcribe : 5' AUG^ GCV^ VAC^ UUC^ US MRNA^ ↑ Arg Lac O^ is a^ cis-acting^ regulatory^ Dut^ acting^ ,^ only^ affects expression of^ genes^ located^ on^ the^ same^ DNA Bacteria doest nat (^) Perform S' (^) capping on their MRNAS S' (^) cappins is in Eukaryotic repressor cannot^ bind to DNA^ by itself when (^) correspsor binds to (^) repressor it activates it protein
  1. Please select the correct matches of regulatory proteins and their corresponding regulatory elements/sequences in eukaryotes: A. Activators - Silencers B. Activators - Enhancers C. Repressors - Silencers D. Repressors - Enhancers E. Two of the above are correct 94.What is the role of the Mediator protein in eukaryotic gene regulation? A. It mediates the binding of the spliceosome. B.It mediates the interaction between transcription factors bound to regulatory sequences and the general C. transcription factors and RNA polymerase in the promoter region. C. It mediates the synthesis of RNA in 5’ to 3’ direction. D. It mediates the binding of mRNA to the ribosome to initiate translation by placing the initiator tRNA in the P site with the start codon. F. None of the above 95.Regulation of glucocorticoid receptor and its transcriptional activity by the steroid glucocorticoid hormone is an example of which type of transcription factor regulatory Mechanisms in eukaryotes? A. Small molecule effectors B. Protein-protein interactions C. Covalent modification D. Negative feedback E.Attenuation
  2. Chromatin remodeling in eukaryotes can result in what type of changes to the chromatin? A. Change in the position of nucleosomes B. Eviction of histone octamers C. Change in the histone composition of nucleosomes D. Makes the DNA more or less amenable to transcription E. All of the above
  3. The histone code refers to… A. how specific histones code for codons. B. combinations of different histone modifications and their consequences on chromatin structure. C. the code that determines which histone is expressed. D. the order in which histones are assembled to form nucleosomes. E. None of the above
  4. Acetylated histones are associated with which effect on gene transcription? A. Increase in transcription B. Decrease in transcription C. Increase in transcription termination D. Decrease in transcription termination E. Increase in splicing Activators bind^ to^ enhancers^ to^ increase^ transcription Repressor bind^ to^ silencers^ to^ decrease^ transcription GR (^) is a transcription factor that (^) is (^) activated when its to the (^) small (^) molecule Acetylation neutralizes the (^) positive charge on^ histones reduces their^ affinity for negatively charged^ DNA Loosens chromosome^ -^ >^ increasing transcriptio n.
  1. Transcripts are categorized as non-coding RNAs based on which of the following characteristics? A. They do not code for proteins but rather function as RNAs. B. They are not encoded by a DNA sequence, hence the name. C.They use a different genetic code and codons than mRNAs. D. They interfere with the interaction between codons and tRNA anticodons. E. All of the above. What is a possible consequence of mutation within the enhancer region of a eukaryotic gene if the activator protein is no longer able to bind? A. There is a decrease in transcription. B. There is an increase in transcription. C. A different amino acid will be added to the resulting protein. D. A codon for an amino acid in the gene will be converted into a stop codon. E. The reading frame will be shifted in the resulting mRNA during translation. Alkylation of DNA can affect DNA replication and transcription. How do cells repair such damages? A. These damages cannot be repaired and the cell dies. B. These damages are also repaired by photolyase. C. These damages can be directly reversed by alkyl transferase enzymes which remove the alkyl group. D. Nothing is done to repair this type of damage. Alkylated DNA has no effect on replication or transcription. E. Nothing is done to repair this type of damage since they help give rise to new genetic variation and alleles, and this is the act For a repressible gene in bacteria, the binding of a small-molecule corepressor to a repressor... A) prevents it from binding to DNA. B) helps it bind to DNA. C) inhibits gene transcription. D) prevents RNA polymerase from binding to the promoter. E) two of the above Non Coding^ RNa are RNA molecule not transcribed from (^) DNA have (^) functional tRNA - (^) carries amino acids^ roles URNA- structural/catalytic^ component^ ribosomes SURNA-involved in (^) splici 100]

For organisms which use photolyase to repair thymine dimers, what is the source of energy used to break the bonds which form the dimers? A) Light B) ATP C) GTP D) cAMP E) Allolactose Which type of mutation is the most likely to give rise to a new allele for a gene? A) Silent B) Nonsense C) Frameshift D) Missense E) Common sense The wild-type mRNA has the following sequence at the beginning of the coding region (the codons are shown, including the start codon): AUG GCC GGA CUU UUU GCC Which of the following is the resulting amino acid sequence if an A is inserted between the first and the second codons (use the Genetic Code table included in the exam)? A) Met, Ala, Gly, Leu, Phe, Ala B) Met, Ser, Arg, Thr, Phe, Cys C) Met, Gly, Ala, Phe, Cys, Pro D) Met, Thr, Ala, Gly, Leu, Lys E) Can't determine using the information given. It is possible for mutations to have no effect on the amino acid sequences of resulting proteins. These are known as nonsense mutations. True or False? A) True B) False Mutations can have both positive and negative consequences for gene function and the evolution of organisms. True or False? A) True B) False

Photolyase is^ an^ enzyme that^ repairs^ UV^ induced thyime.^ Uses^ Light^ to^ break^ the^ covalent^ bonds

· : creates premature^ stop^ codon : Disrupts^ the^ entire^ protein : (^) change a^ single codon^ so^ that^ it (^) codes for a different amina^ acid

  • > N/A

AUG A GCC^ GGA LOO 00O^ GLL -- (^) L Met (^) Ser Arg (^) Thr

Silent :^ are mutations^ that^ do^ not^ change the^ amino^ add Sequence Nonsense : premature stop^ codon

According to the RNA World theory on the origin of the molecular components and mechanisms of life,... A) RNA contained genetic information and catalyzed chemical reactions in protobionts. B) RNA was the only molecule when the first cells formed. C) RNA was the earliest molecule found on the planet. D) First proteins were made with RNA nucleotides instead of amino acids. E) RNA was the energy source used by protobionts. Non-coding RNAs can carry out their functions by interacting with which of the following types of molecules? A) DNA B) RNA C) Protein D) Small molecule/chemical compound E) All of the above.

Lac Repressor^ a^ Protein