BIO 208
Genetics
Homework Translation
1. Fill in the information in the cells that are blank by using the information that is given. There may be
more than one correct answer for some. A codon table is provided on the next page.
DNA Non-template strand "ATG "AGC "AC
C
GGG "CCT
DNA Template strand TAC "TCG "TG
G
"CCC "GGA
mRNA AUG "AGC "AC
C
"GGG CCU
tRNA "UAC UCG "UG
G
"CCC "GGA
Amino Acid met cys trp pro gly
2. Below is a sequence of DNA nucleotides that reflects an mRNA transcript. (In other words, Ts are
shown instead of Us).
ctgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa
There are 3 possible reading frames shown below with corresponding amino acids in FASTA format
1 ctg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa
L P K L N S V E G F S S F E D D V *
2 c tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agg acg atg tat
C P S * I A * R G F H H L R T M Y
3 ct gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata
A Q A E * R R G V F I I * G R C I
a. Which reading frame (1, 2, or 3) has the longest open reading frame? Use a codon table to assist you (note,
the codon table you use may indicate U or T. This does not matter).
Reading frame 3 is the longest.
b. Which reading frame yields the shortest protein? How many amino acids long is this “truncated” protein?
Reading frame 1 is the shortest and is only 1 amino acid long.
c. What are the first 5 amino acids of the longest protein (use full name of amino acids)? (table next page)
Methionine Alanine Serine Proline Leucine Lysine STOP
