Download Restriction Enzymes (Endonucleases) Mapping and more Schemes and Mind Maps Biochemistry in PDF only on Docsity!
.. i.d .i,:ia
'.Ia
'fi:A
..:'i4 I :lt&^I ,rre ..,fiq ,t;4 1 ,. d (^) 'l
,,n t,*x ia
-. { , " 1 ' ]d
,'.d , d
. t^3 : i a : d ,;a . ' d
,d
". d ..
. \ t
1d
. 1 . d
0tir-t^uu
. (^) to understand the concept of DNAdigestion e (^) to understand how gel electrophorcsis separatesdigested DNAfragments r (^) to construct a restric-tioh (^) map with data obtained from gel electrophoresis
Restriction map is defined as a physical map of DNA showing the relative positions of restriction enzyme cleavage sites. To understandthe concept of restriction mapping, a clear description of restriction enzymes and the sites where they cut the DNA is needed.
RestrictionEnzymes(Endonucleases) Many molecular genetic techniques are rooted in the abiiity to digest (also referred to as cutting or cleaving) DNA molecules in a specific and predict- able way. The key to this technoiogy is the discovery of restriction enzymes or restriction endonucleases in bacteria. Speciesofbacteria make restriction enzymeswhich recognize palindromic (inverted repeats)nucleotide sequences of DNA, called restriction sites, and cleave the DNA at those sites generating a 5/ phosphate and a 3/ hydroxyl group at the point of cleavage. Restriction sites are usually 4,6, or 8 basepairs (bp) long. Restriction enzymesare named after the bacteria from which they are isolated. This is done with the first letter of the genus^ followed by the first two letters of the species.The lpe of strain or substrain sometimesfollows the speciesdesignation in the name. A Roman numeral is always used to indicate whether the particular enz;We was the first isolated,the second,the third, and so on. For example,the first enzyme that was isolated from the strain RY13 of the bacterivrn Escherichia coli (commonly known as E. coli) is cailed EcoRl. Several hundred restriction enzymeshave been identified and isolated and are available commercially. Restriction enzymesare classifled as Type I and Type II, both types recogniz- ing specific restriction sites.However, there is a major difference betweenthem. Tlpe I restriction enzymesdigest the double-strandedDNA at random far from their restriction sites,thus createindistinct restriction fragments.For this reason, Type I reshiction enzymeshave no practical value in molecular genetics.Type II restriction enzymescleavethe double-strandedDNAwithin (or very close to) their reshiction sites producing discrete and predictable restriction fragments. This type of restriction enzymes is used in the laboratory for DNA analysis. For example, EcoRi recognizesthe sequence5/GAATTC 3/ and makes a stag- gered cut producing sticky ends that have basepair overhangs(Fig. 3-1A). Or, the enzyme HaeIII recognizes the sequence5/GGCC 3/ and cuts both strands of the DNA between the same nucleotide pairs to produce blunt ends (Fig. 3-18). By using the same restriction enzyme to cut the DNA from two differ- (A) (B) EcoRI HaelTl 5' GAATTC 3' 5NGGCC 3' 3' crrAAaG 5' 3' ccacc 5' f.6.91 , Generation of stag- gered (A) and blunt (B) ends 5, c AATTC 3, 5, cc CC 3, in pieces of DNA digested 3, CTTAA (^) G 5, 3, CC GG S' with EcoRl and Haelll, re-
Staggeredends Bluntends (^) position of cut.
s
.. 4
'6r,
T. -" , & r, . i4.
.a
'e.,
-.d Fi
n
F, a
ent species,complementaryendswill be createdthat will
allow theDNA from the two speciesto stick together.Thus,
recombinantDNA canbe generated.
It should be emphasizedthat bacteria,sown DNA is
not digestedby the enzymestheyproduce.This is because
a groupof enzymes,calledmethylases,recognizethe sites
that would be recognizedby the cell's restrictionenzymes
andadda methyl group (-CH") at thosesiteson thenewly
forming daughter strand. This methylation shields the
bacterialDNA from recognitionby the cell,s own restric-
tion en4nnes.
Table3-l showsthe characteristicsof somecommonlv
usedrestrictionenzymes.
Constructionof RestrictionMaps
The DNA pieces generatedby the action of restriction
enzymesin a fragmentof double-shandedDNA are called
restriction digests. By means of gel electrophoresis,
Tdtc 7-1, Characteristicsof some commonly used
restriction enzymes.Position of cut is shown by
arrowheads.
Enzyme (^) Source (^) Sequencerecognized
restriction digestscan be separatedby size, and on that
basis,a restriction map of the original DNA canbe recon-
stucted.Considerthe following example.
A 10-kb linear piece of DNA has beendigestedonce
with Enzyme X, once with Enzyme y, and once with a
mixture of EnzyrnesX andY (refened to asdouble diges-
tion). Then the reskiction fragmentsof eachreaction are
separated,according to their molecular size, by agarose
gel electrophoresisfig. 31A). Also, a DNA ladder(see
Exercise2) hasbeenelectrophoresedto estimatetl.e sizes
of the fragments.Sincethe size of the DNA fragmentsin
the ladderis known, the sizeof the fragmentsgeneratedby
EnzymeX, Y, or a combinationof both can be estimated.
As shownin Fig. 3-2A, when the 10-kbpieceof DNA is
cut with En4me X, a7 and3-kb DNA fragmentis gener-
ated.This indicatesthat thereis only onerestrictionsite for
En4rme X in the lO-kb DNA fragment. Similarly, when
the sameDNA is cut wittr En4rmeY, two bandsof sizesg
and2 kb aregenerated.Here againthereis only onerestric-
tion site for Enz}rmeY. However,when the 10-kbDNA is
digestedwith both en4fmes,tlree bands,5, 3, and2 kb in
size,aregenerated(seeFig. 3-2A).
To constructthe restrictionmap of the DNA, the 3-kb
Enrpe X site can be arbitrarily placedin one end of the
DNA andthe 8-kbEnzymeY sitein the sameend(seeFig.
3-28 and C). Cutting the DNA with both enzymes,three
bandsofsizes 5, 3, and 2kb aregenerated.The resultson
the gel (seeFig. 3-2A) show that the 2-kb fragmentfrom
En4rme Y digestion remains unaffected in the double
digest,whereasthe 8-kb fragmentfrom the samedigestion
hasbeensplit into two bandsof 5 and3 kb. This resultindi-
t 0 6 6
Antltrobacter luteus
V 5' AGCT3' 3 ' T C C A5 '
V 5'GGATCC3' 3',CCTAGC5' A
5'CAATTC3' 3'CTTAAC5' A v 5 ' A A G C T T3 ' 3 ' T T C C A A5 ' A
5 ' C A T A T G3 ' 3'CTATAC5'
Baci I lus arnyloI i quefaciens H
Escherichia (^) coli RY l
Nocardia otitidis-caviarium (^) 5, GCCGCCGC 3, 3 ' C G C C G G C G5 ' A
DNA (^) [tr4,ms nnzymc Enzyms ladder X Y (^) X+y
\E
r*t F € e p e e e e e e
|'-
e F e e e e e e e e e e e
F'
e
e e
e '|i*
P' f flsv
FF*
E+.
!!*"
EcoRl
Ndel
Ps/l
H aentophi lus influenza Rd
Neisseria denitrifi cans
Providencia saartii
Slrepl omyces achro no genes
v 5 ' C T C C A G 3 ' 3 ' G A C G T C 5 ' A V 5'GAGCTC3' 3'CTCGAG5' A
5'AGTACT]' 3'TCATGA5' A
B (^) EnzymeX
C EnzymeY
3 0_l (^) t 0
8 0 1 (^) t 0
3 X (^5) Y 2 D (^) EnzymesX+Y O_l-- (^) |
t"5. 3-2, Gonstructionof a restriction map for two
hypotheticalEnzymesX and y.
I I I I
I I I I : I I
r
Sacl
StreptomJ'ces caespi I osus
bp
12, ' t1 , 1 9 9 1 0 , 1 8 0 9, 8, 7, 6 , 1 0 8 5, 4, 3, 2, 1,
1 , 0 1 8
- DoubleDigestion
Doubledigestionis a commonproce-
dure in restriction digestion, during
which a pieceof DNA is digestedby
two enzymesat the same time (see,
e.g. Fig. 3-5A). In double digestion,
it is essentialto choosea buffer that
ensuresthe most activity for both
en4lmes. Furthermore, if BSA is
requiredfor eitherenzyme,it mustbe
adddedto the doubledigestionreac-
tion. BSA will not inhibit the activity
of the enzymethat doesnot require
it. A completelist of suggestedbuf-
fers for double digestion can be
found in the TechnicalReferenceof
the New England Biolabs Catalog,
2002-2003(or newereditions)(New
EngladBiolabs,Ipswich,MA). In the
case that no single buffer is found
for a double digestionreaction, the
digestionmustbe donesequentially.
First, the reaction is digestedwith
one enzyme + buffer combination,
then the digestedreaction is frrrther
digestedwith the secondenzyme+
buffer combination.Seekadvicefrom
the laboratoryinstructorfor choosing
a buffer for doubledigestion.
F, E*
F'€*{
Fe
F e e e F e e e e
f,.
e a e e a e e e e e e e
e)
e
e
ei
f:t.3-5.(A) Restrictiondigestof the phagelambdaDNAand (B)the 1-kb
DNAladder.Note that {A)and (B) are not to the same scale.
- Buffer
To ensureoptimal activity, restriction enzymesare used
with appropriatebuffers.The manufachrersprovide a buf-
fer with eachrestrictionenzyme.Somerestrictionen4trnes,
in additionto a buffer,requirebovine serumalbumin(BSA)
for optimal activify. The BSA is usually suppliedby the
manufacfurersat 100x concentration.It mustbe dilutedto
10x in distilledwaterbeforeuse.
- IncubationTemperature
The incubation temperaturefor most restriction enzymes
is 37'C. However, consult manufacturer,srecommenda-
tion beforeincubatingreactions.An i:rcubatoror waterbath,
adjustedto 37"C,canboth be usedfor restrictiondieestion.
- IncubationTime
Incubation time varies dependingon the amount of the
enrqe used(seealso RestrictionEnzyme,above)and the
soluceof theDNA employed.Usuallya 45-minto l-h incu-
bation is sufficient to digest viral or bacterial DNA under
optimal conditions, whereaseukaryotic DNA requires an
overnightincubation.
6. Oder of Preparation of Digestion Reactions
In preparingdigestionreactions,it is extemely important
to add the solutionsin the following order: distilled water,
buffer, BSA (if required),DNA, and enzyme.The reaction
must be thoroughlymixed prior to incubationto achievea
completedigestion.
Materials PhagelambdaDNA, concentration100nglpl BcoRI EcoRIbuffert HindIlI Hindlll buffert I x TBE (Tris*Borate-EDTA) (^) buffer, to be usedfor electrophore- sisandpreparingthe gel: Perl000mLofdH"O 54 g Tris 27.5 gBoic (^) acid (^20) mL 0.5MEDTA, pH 8. This is 5 x TBE and (^) is usedas a stock;the working solu- tion is 1x TBE, i.e., 1 part (^) stock+ 4 partsdH"O. To prepare0.5MEDTA seeExercise2. DNA ladder,as describedin Exercise dIIrO Agarose Gel-loadingdye,asdescribedin Exercise 2 Ethidium bromidesolution,as describedin Exercise Ice Agarosegel electrophoresisunit, as (^) describedin Exercise 2 Microwave (^) oven 200 mL flasks Microtubes,0.6mL Microtube racks Microcentrifuge Micropipettors
T Note: ManuJacturers provide enzymes with appropriate buffers; consuit manufacturers' recommendafi on.
e'
e:
e'
F$
Ft
t!-- F: p*.
(^7) :i-g.. , ,.::q : ,. ' ' 1 .," -nrd fi{'^ l l
-:.J
1 q ,*!t .t: .11t j 1! ' ,,.nt TubeEH Tips 37oCincubator Gel stainingdishes,asneeded Gloves W protectiveglassesor shields Agarosegelphotodocumentationsystem,asdescribedin Exercise 2 Procedure
- Placefow 0.6-mLmicrotubesoniceandlabelthemE
(for EcoRI), H (for HindIII), EH (for Ec oRI + HindIlI), andNO (forno enryrmecontrol).
- Set up digestion reactions (^) in the order shown below:
TubeE TubeH Estimate the size of the bands in help of the DNA ladder in Lane I. Fill in the Table shown below: Lanes 2 to 5 by the Fragment sizes Lane 1 Lane2 Lane3 Lane 4 Lane 5 12.Compareyourgelwiththesamplegelshownin Fig.3-5. W A"o,f;^ 3-1. kr the representationof the piece of DNA shownbelow, find and name restriction enryme recognition sites. 5/AATCTCCTATACGCCGATCCTGAOCCTATCCCAOCTCCATAGTAICAGTACTGCCT 3 / 3 / TTAGACGATA-TCCGCCTAOCACTCGCATACGCTCCACCIAICATACTCATGACCGA5/ 3-2. What is partial digestion and how does it occur? 3-3. A 10-kb linear DNA fragment was digestedonce with EnzymeA, once with En4rme B, and once with Enzyme C. The following fragments were obtained. EnzymeA:2 kb EnzymeB: 0.6kb EnzymeC: 3 kb 8 k b 9. 4 k b 7 k b Restriction enzymedigestsusing two enzl'mes in combination produced the following fragments. EnzrlmeA+B:0.6kb EnzymeA+C:2kb^ EnzymeB+C:0.6kb
- 4 k b 3 k b 3 k b 8 k b 5 k b 6. 4 k b Construct the reskiction map of the DNA.
ffiro EcoRI buffer LambdaDNA EcoRI pL I J 2 3 2 pL 1 3 2 3 2
t 5
2 3
I J I 3 t I dHro .IlindIII bu er LambdaDNA HindlIl TubeNO ffiro ScoRI buffert LambdaDNA EcoRI HindIlT dHro EcoRI buffer LambdaDNA J.
f Note that in the double digest (Tube EH) the EcoRI^ digestion buffer is used. Tap the bottom of the tubes with a finger to mix the reagents,then centrifuge briefly (about 5 s). Digest the DNAby placing the tubes ina37"C incuba- tor for 45 min. Note: Limiting the time of incubation will (^) result in partial digestion of the DNA; that is, only a portion of the available restriction sites will actually be cut with the enzyme. This also can occru when sufficient amount of enzyme is not used. During the incubation time, prepare a 0.8% (w/v) aga- rose gel with I x TBE buffer, and (^) setup the electropho- resis unit as describedin Exercise 2. After 45 min, remove the tubes from the incubator, add 5 pL of gel-loading dye to each tube, and mix well by pipetting up and down. Briefly centrifuge the tubes to push the contentsto the bottom of the tubes. Load the gel as indicated below.
WellNo. Samole
I
2 3 ^ 5
3 ;lL of DNA ladder 10pL ofthe contentoftube E 10pL ofthe contentoftubeH 10pL ofthe contentoftubeEH 10pll,of the contentof fubeNO
- Electrophorese at 90 V for about 45 (^) min. You
may shorten the electrophoresis time by choosing a higher vohage; seek advice from the iaboratory instructor.
- (^) View the DNA (^) bands on a IJV transiiluminator and
photograph (^) the gel.
2 ,?
? a?
3 a B
F P 3 4
