Molecular Biology: Ribosomes, Transcription, and Gene Regulation, Study Guides, Projects, Research of Biology

A detailed overview of key concepts in molecular biology, focusing on ribosomes, rna primers, and the processes of transcription and translation. It explains the roles of various enzymes such as dna helicase, primase, and polymerase, and describes the mechanisms of operon regulation in prokaryotic cells. The document also covers horizontal and vertical gene transfer, plasmids, and techniques like pcr for detecting antibiotic resistance genes. This information is valuable for students studying genetics and molecular biology, offering a comprehensive understanding of gene expression and genetic diversity. (400 characters)

Typology: Study Guides, Projects, Research

2023/2024

Uploaded on 07/02/2025

stupeed
stupeed 🇺🇸

33 documents

1 / 16

Toggle sidebar

This page cannot be seen from the preview

Don't miss anything!

bg1
Bio 15 Microbiology Ch 8 Genetics Study Guide
Key Terms
Ribosome: an RNA-protein complex that performs protein synthesis. A ribosome is composed of 3 sites called
E, P and A. The ribosome is the site of which translation occurs. Ribosomes have a large and small subunit,
each constructed from ribosome RNA (rRNA) and protein.
The A (amino acid) site is where the tRNA, with attached amino acids, bind to the mRNA codon.
The P (polypeptide) site is where the tRNA adds its amino acids to the polypeptide chain.
The E (exit) site is where tRNA resides before being released from the ribosome.
A sequence of amino acids, called a polypeptide, grows from the N-terminus to the C-terminus. This
polypeptide chain represents the primary structure of a protein.
Codon: the mRNA nucleotide triplets are called codons. The codons are written in the 5’-to-3’ direction. Each
codon encodes one amino acid.
Secondary structure: Secondary level of protein structure is formed by the week bonds between oxygen and
hydrogen atoms within the polypeptide backbone.
Nucleotides DNA is a macromolecule composed of repeating units called nucleotides. Each nucleotide consists
of a nucleobase (adenine, thymine, cytosine, or guanine), deoxyribose (a pentose sugar), and a phosphate
group.
Genotype The genetic makeup of an organism. Ex: bb where b is recessive allele for blue eye color
Phenotype The external manifestations of an organism’s genotype, or genetic makeup. Ex: blue eye color
genetic code The mRNA codons and the amino acids they encode. Ex: "AUG"
Genome One complete copy of the genetic information in a cell. Ex: the human genome (all the DNA in a
human cell)
chromosome The structure that carries hereditary information, chromosomes contain genes. Ex: 22 pairs of
chromosomes and XX/XY.
Gene A segment of DNA (a sequence of nucleotides in DNA) encoding a functional product. Ex: the "BRCA"
gene associated with breast cancer risk
regulatory gene called the I gene encodes a repressor protein that switches inducible and repressible operons
on or off.
structural gene to determine the structures of proteins to distinguish them from an adjoining control region
on the DNA.
purine The class of nucleic acid bases that includes adenine and guanine. Ex: Examples of purines
include=adenine, guanine, hypoxanthine, and xanthine.=Purines are nitrogenous bases that are found in meat
and DNA.=
Pyrimidines The class of nucleic acid bases that includes uracil, thymine, and cytosine. Ex:=cytosine, thymine,
and uracil;=cytosine and thymine are found in DNA, while cytosine and uracil are found in RNA.=
antiparallel arrangement The sugar-phosphate backbone of one strand is upside down, or antiparallel, relative
to the backbone of the other strand.
semiconservative replication As the replication fork moves along the parental DNA, each of the unwound
single strands combines with new nucleotides. The original strand and this newly synthesized daughter strand
then rewind. Because each new double-stranded DNA molecule contains one original (conserved) strand and
one new strand, the process of replication is referred to as semiconservative replication.
Primer short sequence of nucleic acid (usually RNA in living organisms) that acts as a starting point for DNA
synthesis, essentially telling the DNA polymerase where to begin building a new DNA strand. Ex: RNA primer A
short strand of RNA used to start synthesis of the lagging strand of DNA, and to start the polymerase chain
reaction. RNA primers used in DNA replication, PCR primers used to amplify specific DNA regions in laboratory
techniques like PCR, sequencing primers used to initiate DNA sequencing, and reverse transcription primers
used to convert RNA into cDNA.
pf3
pf4
pf5
pf8
pf9
pfa
pfd
pfe
pff

Partial preview of the text

Download Molecular Biology: Ribosomes, Transcription, and Gene Regulation and more Study Guides, Projects, Research Biology in PDF only on Docsity!

Bio 15 Microbiology Ch 8 Genetics Study Guide Key Terms Ribosome: an RNA-protein complex that performs protein synthesis. A ribosome is composed of 3 sites called E, P and A. The ribosome is the site of which translation occurs. Ribosomes have a large and small subunit, each constructed from ribosome RNA (rRNA) and protein. The A (amino acid) site is where the tRNA, with attached amino acids, bind to the mRNA codon. The P (polypeptide) site is where the tRNA adds its amino acids to the polypeptide chain. The E (exit) site is where tRNA resides before being released from the ribosome. A sequence of amino acids, called a polypeptide, grows from the N-terminus to the C-terminus. This polypeptide chain represents the primary structure of a protein. Codon : the mRNA nucleotide triplets are called codons. The codons are written in the 5’-to-3’ direction. Each codon encodes one amino acid. Secondary structure: Secondary level of protein structure is formed by the week bonds between oxygen and hydrogen atoms within the polypeptide backbone. Nucleotides DNA is a macromolecule composed of repeating units called nucleotides. Each nucleotide consists of a nucleobase (adenine, thymine, cytosine, or guanine), deoxyribose (a pentose sugar), and a phosphate group. Genotype The genetic makeup of an organism. Ex: bb where b is recessive allele for blue eye color Phenotype The external manifestations of an organism’s genotype, or genetic makeup. Ex: blue eye color genetic code The mRNA codons and the amino acids they encode. Ex: "AUG" Genome One complete copy of the genetic information in a cell. Ex: the human genome (all the DNA in a human cell) chromosome The structure that carries hereditary information, chromosomes contain genes. Ex: 22 pairs of chromosomes and XX/XY. Gene A segment of DNA (a sequence of nucleotides in DNA) encoding a functional product. Ex: the "BRCA" gene associated with breast cancer risk regulatory gene called the I gene encodes a repressor protein that switches inducible and repressible operons on or off. structural gene to determine the structures of proteins to distinguish them from an adjoining control region on the DNA. purine The class of nucleic acid bases that includes adenine and guanine. Ex: Examples of purines include adenine, guanine, hypoxanthine, and xanthine. Purines are nitrogenous bases that are found in meat and DNA. Pyrimidines The class of nucleic acid bases that includes uracil, thymine, and cytosine. Ex: cytosine, thymine, and uracil; cytosine and thymine are found in DNA, while cytosine and uracil are found in RNA. antiparallel arrangement The sugar-phosphate backbone of one strand is upside down, or antiparallel, relative to the backbone of the other strand. semiconservative replication As the replication fork moves along the parental DNA, each of the unwound single strands combines with new nucleotides. The original strand and this newly synthesized daughter strand then rewind. Because each new double-stranded DNA molecule contains one original (conserved) strand and one new strand, the process of replication is referred to as semiconservative replication. Primer short sequence of nucleic acid (usually RNA in living organisms) that acts as a starting point for DNA synthesis, essentially telling the DNA polymerase where to begin building a new DNA strand. Ex: RNA primer A short strand of RNA used to start synthesis of the lagging strand of DNA, and to start the polymerase chain reaction. RNA primers used in DNA replication, PCR primers used to amplify specific DNA regions in laboratory techniques like PCR, sequencing primers used to initiate DNA sequencing, and reverse transcription primers used to convert RNA into cDNA.

primase An RNA polymerase that makes RNA primers complementary to a DNA template acting as a starting point for DNA synthesis during DNA replication. Ex: DnaG protein found in bacteria, which is responsible for synthesizing RNA primers during DNA replication replication fork The point at which replication occurs. A replication fork is a Y-shaped structure that forms when DNA double helix unwinds and split/separates into two strands. This is where DNA replication takes place. leading strand the leading strand is a DNA strand that is synthesized continuously during DNA replication from the primer by DNA polymerase. It runs in the 5' to 3' direction towards the replication fork. lagging strand the lagging strand is a DNA strand that is synthesized discontinuously in small fragments called Okazaki fragments. Primase, an RNA polymerase, synthesizes a short RNA primer, which is then extended by DNA polymerase and finally linked together by DNA ligase. Transcription is the synthesis of a complementary strand of RNA from a DNA template. The genetic information in DNA is copied, or transcribed, into a complementary base sequence of RNA. Translation The cell uses the genetic information encoded in this RNA to synthesize specific proteins mRNA carries the coded information for making specific proteins from DNA to ribosomes, where proteins are synthesized. tRNA: read codons and deliver the amino acids. mRNA: carry the genetic information from DNA. rRNA catalyze (thuc day) the assembly of polypeptide chains. Anticodon a sequence of three nucleotides located on a transfer RNA (tRNA) molecule that is complementary to a specific codon on messenger RNA (mRNA), allowing the tRNA to bring the correct amino acid to the ribosome during protein synthesis, ensuring the accurate translation of genetic information into a protein sequence. Codon A codon is a DNA or RNA sequence of three nucleotides (a trinucleotide) that forms a unit of genomic information encoding a particular amino acid. DNA polymerase synthesizes DNA; proofread and facilitate repair of DNA. Ex: DNA polymerase α: Primarily involved in initiating DNA replication by binding to the RNA primer. DNA polymerase δ: Plays a major role in synthesizing the lagging strand during replication. DNA polymerase ε: Primarily responsible for synthesizing the leading strand during replication. DNA polymerase γ: Located in the mitochondria and responsible for replicating mitochondrial DNA. Gyrase When replication begins, the supercoiling is relaxed by topoisomerase or gyrase. Helicase The two strands of parental DNA are unwound by helicase and separated from each other in one small DNA segment after another. Ligase A ligase is an enzyme that joins two molecules by forming a new chemical bond. Ligases are essential for DNA replication, recombination, and repair. RNA polymerase RNA polymerase is an enzyme that copies DNA into RNA. This process is called transcription and is the first step in gene expression. promoter region A promoter region is a DNA sequence that controls when and how a gene is transcribed. It's located upstream of a gene, or at the 5' end of the transcription start site. Transcription factors and RNA polymerase bind to the promoter region The promoter region interacts with other factors to initiate transcription Transcription produces an RNA molecule, such as mRNA AUG The AUG codon is the start codon, which signals the beginning of protein translation. It's the most common start codon and is present at the beginning of messenger RNA (mRNA). Operator a specific DNA sequence located within an operon that acts as a binding site for regulatory proteins, like repressors, which control the transcription of nearby genes, essentially turning gene expression on or off depending on the environmental conditions; essentially acting as a switch to regulate the level of gene

facilitated by a structure called a pilus; this is considered a form of horizontal gene transfer in bacteria and is a key mechanism for spreading traits like antibiotic resistance. F factor also known as the "fertility factor," is a small piece of DNA (plasmid) found in certain bacteria that allows them to initiate conjugation, a process where genetic material is transferred between bacterial cells; essentially, a bacterium with the F factor can transfer genetic information to a bacterium that lacks it, enabling horizontal gene transfer within a bacterial population. pilus a hair-like protein appendage found on the surface of many bacteria, primarily used for attachment to surfaces or other cells, essentially acting as a means for bacterial adhesion and colonization; the term "pilus" is Latin for "hair" and its plural form is "pili". Plasmid small, circular DNA molecules that are separate from a cell's chromosomal DNA. They are found in bacteria, archaea, and some eukaryotes. Plasmids can replicate independently and are passed from one cell to another. Okazaki fragments short segments of DNA synthesized discontinuously on the lagging strand during DNA replication. Ex: One new strand, called the leading strand , is synthesized continuously in the 5’-> 3 ’ direction (from a template parental strand running 3’->5’). In contrast, the lagging strand of the new DNA is synthesized discontinuously in fragments of about 1000 nucleotides. These must be joined later by DNA ligase to make the continuous strand. Transformation refers to the process where a cell takes up and incorporates exogenous DNA (foreign genetic material) from its environment, resulting in a stable genetic change within the cell, most commonly observed in bacteria where they can acquire new traits from the acquired DNA; this process is a key mechanism for horizontal gene transfer in bacteria. Transduction the process of transferring genetic material between cells using a virus or viral vector. It can occur between bacterial cells or between eukaryotic cells.

Q&A:

DNA polymerase is an enzyme that copies DNA by adding nucleotides to a DNA strand. This process is called DNA replication. DNA replication is semi-conservative, meaning that each new DNA molecule is made up of one old strand and one new strand. DNA polymerase is responsible for passing genetic information from generation to generation. It's also used in polymerase chain reaction (PCR) to copy DNA molecules in test tubes. DNA polymerases can only add nucleotides to an existing strand, so they require a short primer to start. The enzyme primase usually makes the primer of RNA nucleotides. A primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. In living organisms, primers are short strands of RNA. A primer must be synthesized by an enzyme called primase, which is a type of RNA polymerase, before DNA replication can occur. The 5' and 3' indicate the position of carbon atoms on the deoxyribose sugar molecule that a phosphate group binds to. 5' end: The end of a DNA strand with a phosphate group attached to the 5' carbon of the sugar molecule. 3' end: The end of a DNA strand with a free hydroxyl group attached to the 3' carbon of the sugar molecule.

  1. DNA replication is semiconservative. What does that mean?
  • Because the process of DNA replication in which each new double helix consists of one strand from the original DNA molecule (the "parent" strand) and one newly synthesized strand, effectively "conserving" half of the original DNA in each new copy is called “semiconservative”
  • During replication, the two strands of the original DNA molecule separate, and each strand serves as a template for building a new complementary strand, resulting in two new DNA molecules, each with one "old" strand and one "new" strand.
  • The two strands of parental DNA are unwound by helicase and separated from each other in one small DNA segment after another.
  • Each of the unwound single strands combines with new nucleotides.
  • Each new double-stranded DNA molecule contains one original (conserved) strand and one new strand
  1. What is meant by the statement “the two strands of DNA are antiparallel”? It meant that the two strands of a DNA molecule run in opposite directions along the double helix, with one strand oriented 5' to 3' and the other strand oriented 3' to 5'.
  • The sugar-phosphate backbone of one strand is upside down relative to the backbone of the other strand.
  • This arrangement allows pairing between complementary nucleotides on each strand, forming the stable double helix structure.
  • "5'" and "3'" refer to the carbon atoms on the sugar molecule in the DNA backbone, indicating which end of the strand is attached to a phosphate group (5') and which is attached to a hydroxyl group (3').
  1. Outline the general steps involved in DNA replication of the bacterial chromosome?
  • Two replication forks move in opposite directions away from the origin of replication.
  • the bacterial chromosome is a closed loop, the replication forks eventually meet when replication is completed.
  • The two loops must be separated by a topoisomerase. GAI
  1. Initiation:
  • Replication origin (oriC): Replication begins at a specific designated point on the bacterial chromosome called the origin of replication (oriC).
  • DNA unwinding: Enzymes like helicase break the hydrogen bonds holding the DNA strands together, unwinding the double helix to create a replication bubble.
  1. Elongation:
  • Primer synthesis: A short RNA primer is added to the 3' end of each parental strand to serve as a starting point for new DNA synthesis.
  • DNA polymerase: DNA polymerase III adds nucleotides to the 3' end of the growing strand, following the template sequence of the parental strand.
  • Leading and lagging strands: One strand (leading strand) is synthesized continuously as the replication fork moves forward. The other strand (lagging strand) is synthesized discontinuously in short fragments called Okazaki fragments, each requiring a separate RNA primer.
  1. Termination:
  • Meeting of replication forks:
  • Okazaki fragments are short segments of DNA synthesized discontinuously on the lagging strand during DNA replication, meaning they are created in small pieces rather than a continuous strand. c. All enzymes involved and their functions
  • DNA helicase (unwinds the DNA double helix),
  • Proteins stabilize the unwound parental DNA,
  • DNA primase (synthesizes RNA primers),
  • DNA polymerase III (main DNA synthesis enzyme),
  • DNA polymerase I (removes RNA primers and replaces with DNA),
  • DNA ligase (joins DNA fragments together), and
  • topoisomerase (relieves DNA supercoiling) d. How the cell overcomes the antiparallel problem - A bacterial cell overcomes the antiparallel problem in DNA replication by synthesizing one continuous strand (leading strand) in the 5' to 3' direction and the other strand (lagging strand) discontinuously in short fragments called Okazaki fragments, which are later joined together, allowing replication to occur on both strands despite their opposite orientations. 5’ATCGGCTACGTTCACACACTATACATTTCA3’ 3’TAGCCGATGCAAGTGTGTGATATGTAAAGT5’
  1. Outline the general process of transcription. Include a diagram
  • Transcription is the process where a DNA sequence is copied into a complementary RNA molecule, occurring in three main stages: initiation, elongation, and termination; during initiation, RNA polymerase binds to the DNA promoter region, then in elongation, it moves along the DNA template strand adding nucleotides to build the RNA molecule, and finally, termination occurs when the RNA polymerase reaches a specific sequence signaling the end of transcription and releasing the RNA strand.
  • Initiation: Binding: RNA polymerase enzyme binds to a specific DNA sequence called the "promoter" region, located at the start of a gene. Unwinding: The DNA strands separate slightly at the promoter region, creating a "transcription bubble".
  • Elongation: Nucleotides added: RNA polymerase moves along the DNA template strand (in the 3' to 5' direction) and adds complementary RNA nucleotides to the growing RNA molecule (in the 5' to 3' direction). Base pairing: Adenine (A) on DNA pairs with Uracil (U) on RNA, while Cytosine (C) pairs with Guanine (G).
  • Termination:

Terminator sequence: RNA polymerase reaches a specific DNA sequence known as the "terminator" which signals the end of transcription. Release: The newly synthesized RNA molecule detaches from the DNA template and is released. a. Include the basic enzymes involved and a description of their actions Enzyme involved: RNA polymerase Function of RNA polymerase: Unwinds the DNA double helix, reads the template strand, and adds complementary RNA nucleotides to build the RNA molecule. b. What is the product of transcription? The product of transcription is a single-stranded RNA molecule, also called an RNA transcript, which is complementary to one strand of DNA; this RNA molecule can be messenger RNA (mRNA which carries the code for protein synthesis), ribosomal RNA (rRNA which is part of the ribosome), transfer RNA (tRNA which carries amino acids to the ribosome), or non-coding RNA depending on the gene being transcribed. The end product of transcription is an RNA transcript. This could be any form of RNA such as mRNA (messenger RNA), rRNA (ribosomal RNA), tRNA (transfer RNA), or non-coding RNA. Prokaryotes form a polycistronic mRNA whereas eukaryotes form a monocistronic mRNA. Transcription is catalyzed by the enzyme RNA polymerase. In prokaryotes, all three types of RNA are produced by a single RNA polymerase. In eukaryotes, transcription is catalyzed by three different types of RNA polymerase and each one forms a different type of RNA: RNA polymerase 1 produces rRNA, a component of a ribosome that facilitates translation RNA polymerase 2 produces mRNA, which is responsible for carrying genetic information from the nucleus to the cytoplasm RNA polymerase 3 produces tRNA, which carries the corresponding amino acid to the ribosomes during translation c. What will the cell do with the product? mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of synthesizing a protein. mRNA is created during the process of transcription, where an enzyme (RNA polymerase) converts the gene into primary transcript mRNA (also known as pre-mRNA). This pre-mRNA usually still contains introns, regions that will not go on to code for the final amino acid sequence. These are removed in the process of RNA splicing, leaving only exons, regions that will encode the protein. This exon sequence constitutes mature mRNA. Mature mRNA is then read by the ribosome, and the ribosome creates the protein utilizing amino acids carried by transfer RNA (tRNA). This process is known as translation.

  1. Two methods prokaryotic cells can use to control pre-transcriptional regulation of gene expression were covered in the text. One mechanism is inducible and one is repressible. a. Outline the features of an operon Promoter: A DNA sequence where RNA polymerase binds to initiate transcription. Operator: A short DNA sequence located near the promoter where a repressor protein can bind, preventing RNA polymerase from moving forward and inhibiting transcription. Structural genes: The genes within the operon that code for the proteins with related functions. b. Explain how prokaryotic cells use operons to control gene expression in catabolic reactions (ex. Lactose or some other disaccharide is available) Prokaryotic cells use operons to control gene expression in catabolic reactions, like lactose metabolism, by grouping together genes encoding enzymes needed for a specific breakdown pathway under a single promoter, allowing for coordinated transcription and expression of those genes only when the substrate (like lactose) is present, essentially turning the "operon on" when needed and conserving energy when it's not; a classic example is the lac operon in E. coli, where the presence of lactose induces the transcription of genes required to break down lactose, while the absence of lactose keeps the operon repressed. Gene clustering: In an operon, genes coding for enzymes in a catabolic pathway are clustered together on the DNA, allowing them to be transcribed as a single mRNA molecule. Regulation by a repressor protein: A regulatory protein called a "repressor" typically binds to an operator region on the DNA, preventing RNA polymerase from accessing the promoter and initiating transcription when the substrate is not available. Inducer molecule: When the substrate (like lactose) is present, it acts as an "inducer" molecule, binding to the repressor and causing a conformational change that prevents the repressor from binding to the operator, allowing transcription to proceed. Important aspects of operon regulation: Efficient gene expression: By grouping related genes in an operon, the cell can quickly respond to changes in the environment by turning on or off the entire set of genes needed for a specific pathway. Energy conservation: Operons ensure that the cell only produces enzymes required for a specific substrate when that substrate is actually available, preventing unnecessary protein synthesis. c. Explain how prokaryotic cells use operons to control gene expression in anabolic reactions Prokaryotic cells utilize operons to control gene expression in anabolic reactions, like lactose metabolism, by grouping together genes encoding enzymes needed for a specific pathway under a single promoter, allowing coordinated transcription only when the necessary substrate (like lactose) is present; essentially, the operon acts as a switch, turning on the expression of these genes only when the substrate is available, preventing unnecessary protein synthesis when it's not needed, thus optimizing energy usage. Structure:

An operon consists of a promoter region where RNA polymerase binds to initiate transcription, an operator region where a regulatory protein (repressor) can bind to block transcription, and structural genes that code for the enzymes involved in the metabolic pathway. Inducible Operon: In the case of anabolic pathways like lactose metabolism (lac operon), the operon is considered "inducible" - meaning transcription is only activated when the substrate (lactose) is present. Repressor Protein: When lactose is absent, a repressor protein binds to the operator, preventing RNA polymerase from accessing the structural genes and inhibiting transcription. Inducer Molecule: When lactose is available, it acts as an "inducer" molecule, binding to the repressor protein and causing a conformational change that releases it from the operator, allowing RNA polymerase to transcribe the operon genes. d. Which operon system is repressible and which is inducible? The trp operon is considered a repressible operon, while the lac operon is an inducible operon; meaning the trp operon is normally "on" but can be repressed by the presence of tryptophan, while the lac operon is normally "off" and needs lactose to be induced and turned on. A repressible operon is usually "on" unless a specific molecule (co-repressor) is present to repress it. An inducible operon is usually "off" unless a specific molecule (inducer) is present to induce it. e. Why do prokaryotic cells have these systems? Prokaryotic cells have operon systems because they allow for efficient gene regulation, enabling the cell to quickly adapt to changing environmental conditions by turning on or off multiple related genes simultaneously, which is crucial for their survival in fluctuating environments where nutrient availability can vary rapidly; essentially, it conserves energy by only producing proteins needed at a given time.

  1. The following sequence represents triplets on DNA: TAC CAG AUG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons that correspond with this sequence, and then give the sequence of amino acids in the polypeptide. mRNA: AUG GUC UAC UAU GUG AGG GGU CGC UGA tRNA: UAC CAG AUG AUA CAC UCC CCA GCG ACU Sequence of amino acids in the polypeptide: Met Val Tyr Tyr Val Arg Gly Arg Stop b. Induce a deletion in one of the nucleotide codons. How does the deletion affect the amino acid sequence? A deletion in one nucleotide codon within a gene sequence causes a "frameshift mutation," drastically altering the amino acid sequence downstream of the deletion point because the reading frame is shifted, leading to entirely different codons being read and translated into a completely different protein sequence, often rendering the protein non- functional. c. Add a nucleotide to the sequence above then translate it. Then add two nucleotides and translate it. Then 3 nucleotides and translate it. How does each insertion affect the amino acid sequence?

in its population without the mutation; this can include developing resistance to diseases, better adapting to new conditions, or acquiring new abilities to access resources. Examples: Antibiotic resistance in bacteria: Mutations can give bacteria the ability to survive in the presence of antibiotics. Sickle cell anemia: While harmful in its homozygous form, the heterozygous sickle cell trait provides some resistance to malaria. Lactase persistence in humans: Allows adults to digest lactose (milk sugar). Camouflage coloration in animals: Mutations that allow an animal to blend in with its surroundings, improving its ability to hide from predators.

  1. Explain one way cells can repair mutations in their DNA. Base Excision Repair (BER): This pathway targets single damaged bases like oxidized or alkylated nucleotides. A specialized enzyme, DNA glycosylase, recognizes and removes the damaged base, creating a gap that is then filled by DNA polymerase and sealed by DNA ligase. Nucleotide Excision Repair (NER): This mechanism is used to repair larger distortions in the DNA helix caused by bulky adducts or crosslinks. A complex of proteins identifies the damaged region, excises a short stretch of nucleotides encompassing the damage, and then the gap is filled by DNA polymerase and ligase. Mismatch Repair (MMR): This system corrects errors that occur during DNA replication, like mismatched base pairs. Specific proteins identify the mismatch and then the newly synthesized strand is specifically targeted for excision and replacement with the correct nucleotide. Direct Reversal Repair: Some types of DNA damage, like methylated bases, can be directly reversed by specialized enzymes without the need for excision. Double-Strand Break Repair (DSBR): This pathway repairs double-stranded breaks in DNA, which can be highly detrimental to the cell. Homologous Recombination: This pathway utilizes a sister chromatid as a template to accurately repair the break, ensuring high fidelity. Non-Homologous End Joining (NHEJ): This pathway joins broken DNA ends directly, although it can introduce mutations due to potential loss of nucleotides at the break site.
  2. Differentiate between horizontal and vertical gene transfer.

"horizontal gene transfer" refers to the transfer of genetic material between organisms that are not

direct descendants of each other (meaning not from parent to offspring), while "vertical gene transfer" describes the passing of genetic material from a parent to its offspring through reproduction; essentially, horizontal transfer occurs between individuals of the same generation, whereas vertical transfer happens across generations. Direction of transfer: Horizontal gene transfer occurs between unrelated organisms, while vertical gene transfer happens from parent to offspring. Evolutionary impact: Horizontal gene transfer can lead to rapid genetic diversification within a population as genes can be exchanged across species boundaries, while vertical transfer primarily maintains the genetic characteristics within a species.

Mechanisms: In bacteria, horizontal gene transfer can occur through mechanisms like conjugation, transformation, and transduction, while vertical transfer happens through normal cell division. Example: Horizontal gene transfer: A bacterium acquires antibiotic resistance genes from another unrelated bacterium through conjugation, allowing it to survive antibiotic treatment that would normally kill it. Vertical gene transfer: A bacterium passes on its natural antibiotic resistance genes to its daughter cells during binary fission.

  1. Describe the function of plasmids. GAI: Plasmids are small, circular DNA molecules found in bacteria that function as independent genetic elements, carrying genes that can provide the bacteria with advantageous traits like antibiotic resistance, and can be transferred between bacteria through a process called conjugation, essentially allowing for horizontal gene transfer and adaptation to new environments; scientists also use plasmids as vectors in genetic engineering to clone and manipulate genes due to their ability to replicate independently and easily transfer DNA fragments. Key points about plasmids: -Gene transfer: Plasmids play a crucial role in transferring genes between bacteria, enabling rapid adaptation to changing conditions, including the spread of antibiotic resistance genes. -Independent replication: Unlike chromosomal DNA, plasmids can replicate independently within the bacterial cell. -Genetic engineering tool: Scientists use plasmids as vectors to insert desired genes into bacteria for research purposes, such as protein production. -Small size and circular shape: Plasmids are small, circular pieces of DNA, making them easily manipulated in laboratory settings.
  2. Bacterial organism can share genetic information between cells of the same generation. Three methods for how bacteria can do this was introduced in the text. a. Outline the general steps of each method? transformation (taking up free DNA from the environment), transduction (transfer of DNA via a bacteriophage), and conjugation (direct cell-to-cell contact to transfer DNA). b. Compare and contrast the three on the basis of general method, donor and recipient. c. Why would bacterial cells want to share genetic material? d. Each method results in cells that have been ____________________
  3. Imagine that you are a scientist working for the local health department. Your microbiology laboratory has recently received four cultures of different Gram-negative enteric bacteria, Salmonella typhimurium, Salmonella enteriditis , E. coli , and Shigella species. All organisms were isolated from the same soil samples and were tested to be resistant to the same four antibiotics. Explain one way these four bacteria species could have acquired resistance to the antibiotics. What could you do to confirm your hypothesis? GAI:

Immediate Lactose Utilization: The mutant strain can immediately begin breaking down lactose as soon as it encounters it, potentially giving it a growth advantage over wild-type cells in environments where lactose is abundant. Disadvantage in Lactose-Poor Environments: Wasteful Energy Expenditure: Since the mutant strain continuously expresses the lac operon genes, it will waste energy producing unnecessary enzymes when lactose is not present, putting it at a disadvantage compared to wild-type cells that only express these genes when needed.

16. Corynebacterium diphtheriae, the causative agent of diphtheria, secretes a toxin that enzymatically inactivates all tRNA molecules in eukaryotic cells. What immediate and long-term effects does this have on cellular metabolism? GAI: If Corynebacterium diphtheriae's toxin inactivated all tRNA molecules in eukaryotic cells, the immediate and primary effect would be a complete halt in protein synthesis, leading to rapid cell death due to the inability to produce essential proteins for cellular functions, with long-term consequences including tissue damage and organ failure in the affected organism depending on the extent of toxin spread. Role of tRNA: Transfer RNA (tRNA) molecules are crucial for protein synthesis as they carry amino acids to the ribosome based on the codon sequence on the mRNA. Immediate effect: By inactivating all tRNA molecules, the toxin effectively prevents the translation process, meaning no new proteins can be produced. This leads to a rapid decline in cellular functions, impacting everything from enzyme activity to cell division. Cellular consequences: Disruption of essential pathways: Without protein synthesis, critical metabolic pathways will be disrupted, including energy production, membrane maintenance, and signal transduction. Cell death: As vital proteins cannot be replenished, the cell will eventually undergo programmed cell death (apoptosis) or necrosis. Systemic effects: Tissue damage: If widespread cell death occurs in a particular tissue due to toxin exposure, it can lead to tissue damage and organ dysfunction. Organ failure: Depending on the affected tissue, systemic complications like heart failure (myocarditis), nerve damage (polyneuropathy), and respiratory failure can arise. Key points to remember: Diphtheria toxin specifically targets and inactivates elongation factor 2 (EF-2), which is essential for protein translation, effectively halting protein synthesis. The toxin is released by Corynebacterium diphtheriae and can spread through the bloodstream, causing damage to various tissues in the body. Vaccination against diphtheria is crucial to prevent infection and the associated complications from the toxin. Questions from the book: Review: 1-5, 7 multiple choice: 1, 2, 10, Clinical application: 1 a b c