Docsity
Docsity
Prepare for your exams
Prepare for your exams

Study with the several resources on Docsity

Earn points to download
Earn points to download

Earn points by helping other students or get them with a premium plan

Guidelines and tips
Guidelines and tips
Sell on Docsity
Sell on Docsity
Docsity AI
Docsity AI
Log inSign up

Prepare for your exams

Study with the several resources on Docsity

Find documents

Prepare for your exams with the study notes shared by other students like you on Docsity

Search for your university

Find the specific documents for your university's exams

Docsity AINEW

Summarize your documents, ask them questions, convert them into quizzes and concept maps

Explore questions

Clear up your doubts by reading the answers to questions asked by your fellow students

Earn points to download

Earn points by helping other students or get them with a premium plan

Share documents
download point icon20 Points

For each uploaded document

Answer questions
download point icon5 Points

For each given answer (max 1 per day)

All the ways to get free points
Get points immediately

Choose a premium plan with all the points you need

Study Opportunities

Choose your next study program

Get in touch with the best universities in the world. Search through thousands of universities and official partners

Community

Ask the community

Ask the community for help and clear up your study doubts

Free resources

Our save-the-student-ebooks!

Download our free guides on studying techniques, anxiety management strategies, and thesis advice from Docsity tutors

Assignment about the gene BRCA1, Assignments of Genetics

Ateneo de Manila University (ADMU)Genetics

Your field of research is in studying the gene BRCA1. It is thought that mutations in exon 7 of BRCA1 can cause breast and ovarian cancer.

Typology: Assignments

2019/2020

Available from 07/09/2023

victoria-cuaresma
victoria-cuaresma 🇵🇭

5 documents

1 / 4

Toggle sidebar

This page cannot be seen from the preview

Don't miss anything!

bg1
Follow these rules while completing the assignment:
1. You may use notes, your textbook, and the internet to help you complete the worksheet.
However, you may not use your classmates or your professor; this worksheet is to be completed
INDEPENDENTLY.
2. All answers must be in your own words. Any copying/pasting will result in a deduction of points.
3. Answers do not need to be in complete sentences. However, answers must be intelligible.
4. Unless stated otherwise, the answers should not be “there was a human error” (ex: the
experiment got contaminated, the scientist forgot to add a reagent, etc.)
5. Answers should be submitted in .pdf, .doc, or .docx format.
6. For all sequences, be sure to mark the 5’ and 3’ ends.
pf3
pf4

Partial preview of the text

Download Assignment about the gene BRCA1 and more Assignments Genetics in PDF only on Docsity!

Follow these rules while completing the assignment:

  1. You may use notes, your textbook, and the internet to help you complete the worksheet. However, you may not use your classmates or your professor; this worksheet is to be completed INDEPENDENTLY.
  2. All answers must be in your own words. Any copying/pasting will result in a deduction of points.
  3. Answers do not need to be in complete sentences. However, answers must be intelligible.
  4. Unless stated otherwise, the answers should not be “there was a human error” (ex: the experiment got contaminated, the scientist forgot to add a reagent, etc.)
  5. Answers should be submitted in .pdf, .doc, or .docx format.
  6. For all sequences, be sure to mark the 5’ and 3’ ends.

Your field of research is in studying the gene BRCA1. It is thought that mutations in exon 7 of BRCA1 can cause breast and ovarian cancer.

  1. To study BRCA1 ’s role in breast cancer, you first collect DNA from those with and without breast cancer. Identify at least 5 experimental controls you would maintain in selecting your patients. Some of the experimental controls that needs to maintain includes: (1) the patients should be both with and without breast cancer (2) non-cancer patients should be healthy and has no history of cancer (3) both patients should have a family history of cancer (3) all cancer patients should be under the age of 55 when diagnosed with cancer (4) have no intervening or previous diagnosis of cancer (5) both a second primary invasive contralateral breast cancer discovered at least a year after the initial breast cancer diagnosis and a first primary invasive breast cancer that did not expand past the lymph nodes at diagnosis.
  2. The NCBI website contains information about genes. Browse through the NCBI site for BRCA1 to answer the following questions.
    • What roles do BRCA1 play in the mammalian cell? List at least 2.
    • How many exons does BRCA1 contain?
    • What are 2 genes that have BRCA1 interaction? BRCA1 is needed in DNA repair processes and in DDR checkpoint activation. BRCA1 contains 22 exons. p53 and RNA Polymerase II have BRCA 1 interaction.
  3. You sequence BRCA1 of patients with and without breast cancer. You notice that patients with breast cancer have mutations found in Exon 7. Luckily for you, the NCBI website also contains the gene sequences of the BRCA1 exons. (You will need to open this file in Notepad. The exons are in order in the file. In other words, the first exon = Exon 1, the second exon = Exon 2, etc.). Design a primer set that you can use to amplify Exon 7 of BRCA1 using PCR (one of your primers should be found in Exon 6 while the other primers should be found in Exon 8). Use the Addgene website and their YouTube video to give you a good idea of how to design a primer set (ignore the secondary structure consideration. Try to fit as many of the considerations as possible). Use the BLAST website to ensure that your primers are unique to your gene of interest. Write the primer set you have designed below. F: 5’ CGTCTGTCTACATTGAATTGG 3’ R: 5’TCCCTGGTTCCTTGAGGGGTG3’
  1. You then insert your modified embryonic stem cells into a donor mouse embryo. What kind of mouse strain would you use for the donor embryo? Why? A Rag-2 mouse because they do not produce mature T cells or B cells. Their phenotype can be described as a "non-leaky" immune deficiency.
  2. After several generations, you now how mice with mutated Brca1. You compare these mice to their wild type (non-mutated) littermates and note that mice with the Brca1 mutation have much higher rates of breast cancer. You wish to publish your findings, but your editor asks you to study the protein structure of the mutated BRCA1 too. To do so, you need to isolate BRCA1 from the mouse cells. You decide to perform an affinity chromatography experiment to do so. What molecule could you put on your affinity beads to isolate BRCA1 from your cells? (Assume that the molecule you choose binds to both your mutated and normal BRCA1 proteins. See the NCBI site from Question 2 for help!) glutathione-Sepharose (Amersham Pharmacia) beads could be used to isolate BRCA
  3. Finally, you discover that your mutated BRCA1 does not recognize damaged DNA, leading to increased rates of breast cancer. You publish your work and try to patent your results. However, you discover that you can’t based upon Association for Molecular Pathology v. Myriad Genetics, Inc. (This case is super interesting. When BRCA was first discovered, the company that discovered it tried to patent the BRCA sequence). Oh well. Congratulations on finishing the experiment! (There is no answer to write here; just look over the wiki page).