Download Designer Genes Science Olympiad and more Study Guides, Projects, Research Design in PDF only on Docsity!
1. (1.00 pts) Identify this phase of cell division: A) Prophase of Meiosis I B) Prophase of Mitosis C) Prophase of Meiosis II D) Interphase E) Telophase of Mitosis F) Telophase of Meiosis I 2. (1.00 pts) Identify the phase of cell division shown below: Designer Genes C - Designer Genes - Mentor High Invitational - 02-20-
Instructions (shown before students start the test)
Hello - Welcome to Designer Genes! All 70 questions (even short answer) are worth just 1 point therefore partial points will be given for some short answer questions. Therefore try to answer every question you can :) There is NO NEED to show work for the Punnett Square Questions! Ties will be broken (if needed) by reading through the short answers a 2nd time, looking for most thorough response. Take your time and HAVE FUN!
Introduction (shown after students start the test)
A) Anaphase of Mitosis B) Anaphase of Meiosis I C) Anaphase of Meiosis II D) Telophase of Mitosis E) Telophase of Meiosis I
3. (1.00 pts) Identify this phase of cell division: A) Anaphase of Mitosis B) Anaphase of Meiosis I C) Anaphase of Meiosis II D) Telophase of Mitosis E) Telophase of Meiosis I F) Telophase of Meiosis II 4. (1.00 pts) Identify the phase of cell division shown below:
C) 24
D) 96
9. (1.00 pts) What is the sex and phenotype of this person (based on their chromosomes)? A) Female with Trisomy 21 B) Female with Normal phenotype C) Male with Down's Syndrome D) Female with Klinefelter Syndrome 10. (1.00 pts) What is the sex and phenotype of this person (based on their chromosomes)? A) Female with Klinefelter Syndrome B) Male with Klinefelter Syndrome C) Female with Normal phenotype D) Male with Down's Syndrome 11. (1.00 pts) A person with Turner Syndrome has only one copy of this chromosome. A) Chromosome 1
B) Chromosome 21 C) X Chromosome D) Y Chromosome
12. (1.00 pts) Nondisjunction can occur in either meiosis I or meiosis II. When it occurs in meiosis I, what is the likelihood of a trisomy zygote? A) 100% B) 0% C) 25% D) 50%
13. (1.00 pts) Chris Hemsworth and his wife, Elsa Pataky both have straight hair. They have twin sons. Curly hair (H) is dominant to straight hair (h).
What is the genotype of Chris and Elsa's kids?
A) Straight hair B) Curly hair C) HH D) Hh E) hh
14. (1.00 pts) Ben Affleck has a cleft chin but the mother of his children: Jennifer Gardner does not. Cleft chin (L) is dominant to no cleft chin (l).
Their first-born child does not have a cleft chin. What is Ben's genotype?
A) Homozygous dominant B) Heterozygous dominant C) Heterozygous recessive D) Homozygous recessive
15. (1.10 pts) Irrfan Khan has dimples. Dimples are dominant (D) to no dimples. This means that at least ONE of his parents must have had dimples.
Explain how we know this to be true.
16. (1.10 pts) The individuals who are filled in have the trait being tracked in this family pedigree. Is this pedigree likely tracking a dominant or recessive allele? Explain how you know.
A male rabbit heterozygous for gray hair and black eyes mates with a white hair, red eyed female. What is the expected phenotype ratio of their offspring? A) 4 gray hair, black eye : 4 gray hair, red eye : 4 white hair, black eye : 4 white hair, red eye B) 6 gray hair, black eye : 2 gray hair, red eye : 6 white hair, black eye : 2 white hair, red eye C) 8 gray hair, black eye : 0 gray hair, red eye : 8 white hair, black eye : 0 white hair, red eye D) 9 gray hair, black eye : 3 gray hair, red eye : 3 white hair, black eye : 1 white hair, red eye
20. (1.00 pts) In rabbits, gray hair (G) is dominant to white hair (g), and black eyes (B) is dominant to red eyes (b). These two traits are independent of each other. A male rabbit heterozygous for gray hair with red eyes mates with a white hair, red eyed female. What is the expected phenotype ratio of their offspring? A) 4 gray hair, black eye : 4 gray hair, red eye : 4 white hair, black eye : 4 white hair, red eye B) 0 gray hair, black eye : 8 gray hair, red eye : 0 white hair, black eye : 8 white hair, red eye C) 6 gray hair, black eye : 2 gray hair, red eye : 6 white hair, black eye : 2 white hair, red eye D) 9 gray hair, black eye : 3 gray hair, red eye : 3 white hair, black eye : 1 white hair, red eye 21. (1.00 pts) In Guinea pigs, black hair (B) is dominant over white (b), rough coat texture (R) is dominant over smooth (r), and short hair (S) is dominant over long hair (s). If the parental genotypes were bbRrSs and BbrrSs, what is the probability (out of 64) that their offspring would have the following genotype: BbrrSs A) 32/ B) 12/ C) 4/ D) 8/ 22. (1.00 pts) In Guinea pigs, black hair (B) is dominant over white (b), rough coat texture (R) is dominant over smooth (r), and short hair (S) is dominant over long hair (s). If the parental genotypes were bbRrSs and BbrrSs, what is the probability (out of 64) that their offspring would have the following genotype: bbrrss A) 4/ B) 8/ C) 32/ D) 12/ 23. (1.00 pts) In Guinea pigs, black hair (B) is dominant over white (b), rough coat texture (R) is dominant over smooth (r), and short hair (S) is dominant over long hair (s). If the parental genotypes were BbRrSs and BbrrSs, what is the probability (out of 64) that their offspring would have the following phenotype: Black hair, Rough texture, and Long hair A) 12/ B) 6/ C) 8/ D) 32/
24. (1.10 pts) A rooster with gray feathers is mated with a hen of the same phenotype. Among their offspring, 15 chicks are grey, 6 are black, and 8 are white. a. What is the simplest explanation for the inheritance of these colors in chickens? b. What offspring would you predict from the mating of a grey rooster with a black hen? 25. (1.10 pts) In 1981, a stray black cat with unusual rounded, curled-black ears was adopted by a family in California. Hundreds of descendants of the cat have since been born, and cat fanciers hope to develop the “curl” cat into a show breed. Suppose you owned one of the curled ear cat descendants and wanted to develop a true-breeding variety. The curled ear trait appears to be a result of a dominant allele - describe how you could go about determining if your cat is homozygous dominant or heterozygous. 26. (1.00 pts) In cats, S = short hair, s = long hair, X = black coat, X = yellow coat, and X X = tortoiseshell (calico) coat. If a long-haired yellow male is crossed with a tortoiseshell female heterozygous for short hair, what is the % likelihood that their offspring will be male and tortoiseshell (calico)? A) 50% B) 25% C) 12% D) 0% 27. (1.00 pts) In fruit flies, the gene for eye color is found on the X chromosome. The red eye allele X is dominant to the white eye allele X. A white eyed female mates with a red eyed male. What is the probability that the first egg laid by the female will contain a male with white eyes? A) 0% B) 25% C) 50% D) 100% 28. (1.00 pts) In fruit flies, the gene for eye color is found on the X chromosome. The red eye allele X is dominant to the white eye allele X. A white eyed female mates with a red eyed male. What is the probability that the first egg laid by the female will contain a female with red eyes? A) 0% B) 25% C) 50% D) 100% C c C c R r R r
34. (1.00 pts) If one of your parents is blood type O and the other parent is blood type AB, which of the following blood types is NOT possible for you? A) O B) A C) B D) All of the above are possible 35. (1.00 pts)
An example of epistasis is pigmentation in mice. The wild-type coat color, agouti ( AA ), is dominant to solid-colored fur ( aa ). However, a separate gene ( C ) is
necessary for pigment production. A mouse with a recessive c allele at this locus is unable to produce pigment and is albino regardless of the allele present at
locus A.
If you cross two mice both heterozygous (AaCc), what is the % likelihood that their offspring will be albino? A) 0% B) 25% C) 50% D) 100%
36. (1.00 pts)
An example of epistasis is pigmentation in mice. The wild-type coat color, agouti ( AA ), is dominant to solid-colored fur ( aa ). However, a separate gene ( C ) is
necessary for pigment production. A mouse with a recessive c allele at this locus is unable to produce pigment and is albino regardless of the allele present at
locus A.
If you cross a heterozygous mouse (AaCc) with an albino mouse (AAcc), what is the % likelihood that their offspring will be albino? A) 0% B) 25% C) 50% D) 100%
37. (1.00 pts) The image below shows a DNA replication fork. Which enzyme is labeled #1? A) DNA helicase B) DNA polymerase I C) DNA polymerase III
D) DNA ligase
38. (1.00 pts) The image below shows a DNA replication fork. Which enzyme is labeled #5? A) DNA helicase B) DNA polymerase I C) DNA polymerase III D) DNA ligase E) RNA primase 39. (1.00 pts) The image below shows a DNA replication fork. What is enzyme #2 doing? A) Unwinding the helix / breaking hydrogen bonds B) Adding nucleoside triphosphates from 5' to 3' direction C) Adding nucleoside triphosphates from 3' to 5' direction D) Adding an RNA primer to initiate replication E) Replacing the RNA primer with DNA nucleotides 40. (1.00 pts) Which process of gene expressions is occurring at label "O" in the diagram below? What structures are labeled "N" and "Z"?
A) P = Amino Acid Q = tRNA R = Ribosome B) P = Amino Acid Q = mRNA R = Ribosome C) P = Amino Acid Q = mRNA R = RNA polymerase D) P = Protein Q = mRNA R = Codon
42. (1.00 pts) Which enzyme (in gold below) would be responsible for making this process occur? A) DNA polymerase III B) DNA helicase C) RNA polymerase D) RNA primase
43. (1.00 pts) The base sequence of a fragment of DNA is: GTT CAC CTG GAT
What is the base sequence on the messenger RNA (mRNA) molecule transcribed from it? A) CAA GUG GAC B) CAA GTG CAC CTA C) CUU GTG CUC CTU D) CTT GUG CTC CUA
44. (1.00 pts) In eukaryotic cells, translation cannot begin until A) the mRNA has left the nucleus B) several transcription factors have bound to the promotor region on DNA C) 3' tail consisting of numerous guanine nucleotides has been added
D) the sections of mRNA called exons have been removed from the mRNA
45. (1.00 pts) Which letter (A–D) indicates where a new nucleotide would attach during DNA replication?
A) A
B) B
C) C
D) D
46. (1.00 pts) A strand of mRNA consists of the following nucleotides: AUUCUGGCUA Which of the following represents the non-transcribed (sense) strand of the DNA? A) TAAGACCGAT B) ATTCTGGCTA C) UAAGACCAU D) AUUCUGGGCUA 47. (1.00 pts) The diagram shows how pre-mRNA is processed into mature mRNA. Which structures are indicated by the letters W and X?
D) Silent mutation
53. (1.00 pts) Which of the following is an example of a frameshift mutation? A) A deletion of a codon B) Missense mutation C) Silent mutation D) Deletion of one nucleotide 54. (1.00 pts) Which of the following is the type of DNA repair in which thymine dimers are directly broken down by the enzyme photolyase? A) Direct repair B) Nucleotide excision repair C) Mismatch repair D) Proofreading 55. (1.00 pts) UV light often causes which type of mutation A) Missense mutation B) Methylated DNA C) Pyrimidine Dimers D) Cancer 56. (1.00 pts) In eukaryotes, the mismatch repair mechanism is initiated and directed by A) Methylated DNA strand B) Acetylated DNA strand C) Strand specific nicks D) Double strand breaks 57. (1.00 pts) Endonuclease is involved in which type of DNA repair? A) Base excision repair B) Nucleotide excision repair C) Mismatch repair D) Double strand break repair 58. (1.00 pts) In a person who is heterozygous for sickle-cell anemia, where is the mutation found? A) In every gamete produced B) Only in gametes carrying an X chromosome C) In all brain cells D) In blood plasma
59. (1.00 pts) Sanger developed a method for determining DNA base sequences using terminating nucleotides called dideoxyribonucleotides. After an incubation period, the DNA samples are run on an electrophoresis gel. Results are shown in the diagram. What is the base sequence of the original DNA strand? A) ACGCCCGAGTAGCCCAGATT B) UGCGGGCUCAUCGGGUCUAA C) ACGCCCGAGUAGCCCAGAUU D) TGCGGGCTCATCGGGTCTAA 60. (1.00 pts) Laboratory analysis of DNA from a 40 000 year old woolly mammoth used the polymerase chain reaction (PCR). What role did the PCR have in the analysis? A) DNA denaturation B) DNA comparison C) DNA separation D) DNA amplification
61. (1.00 pts) What happens to DNA fragments in electrophoresis?
A) They move in a magnetic field and are separated according to their size.
B) They move in an electric field and are separated according to their size.
C) They move in a magnetic field and are separated according to their bases.
D)
62. (1.00 pts) The diagram shows results of electrophoresis of DNA from a crime scene.
Which suspect could be implicated as the criminal, according to the gel shown below?
C) Checking the quality and quantity of the fragment library D) All of the above.
65. (1.00 pts) Which sequence best describes the process of DNA microarray? A) Sample prep - cDNA synthesis - hybridization - scan and analysis B) Hybridization - cDNA synthesis - scan and analysis C) cDNA synthesis - scan and analysis - sample prep - hybridization D) Sample prep - cDNA synthesis - scan and analysis - hybridization 66. (1.00 pts) In the DNA microarray, what does the RED color indicate? A) these genes are no expressed or turned off B) these genes are expressed in healthy cells C) these genes are expressed or turned on in cancer D) there are no genes in this cell 67. (1.00 pts) Which polymerase is used in PCR based mutagenesis? A) Deep vent R polymerase B) pfu polymerase C) Taq polymerase D) DNA polymerase 68. (1.00 pts) The cladogram was constructed using DNA base sequences from six species. Which node indicates the greatest difference in base sequences? A) A B) B C) C D) D
69. (1.00 pts) The table shows the number of differences between humans and other selected organisms for the protein cytochrome c oxidase. This protein, consisting of 104 amino acids, is located in the mitochondria and functions as an enzyme during cell respiration. If the data were used to draw a cladogram, which chordates would be furthest apart from humans? A) Chimpanzee because it has zero differences B) Fruit fly because it has the most differences C) Tuna fish because it is the chordate with the most differences D) Horse because it is in the same class 70. (1.00 pts) The cladogram shows the relationships of five species I to V. Which species is/are most closely related to IV? A) V only B) II and III C) III and V D) II, III and V © 2021 - powered by Scilympiad (https://scilympiad.com) | Tournaments (/oh-mhs/Home/Subscribers) Terms of Use (/ToS.html) | Privacy (/Privacy.html) | Cookie Policy (/CookiePolicy.html) | Support (/oh-mhs/Support) | Contact (/oh-mhs/Home/Contact)
