DNA Replication: Essential for Asexual Reproduction in Prokaryotes and Eukaryotes, Study notes of Genetics

Download DNA Replication: Essential for Asexual Reproduction in Prokaryotes and Eukaryotes and more Study notes Genetics in PDF only on Docsity!

DNA Replication

Reminder

• Genes are DNA.
• DNA is a double-stranded molecule.
• The genetic information in a gene is encoded

in the sequence of bases on one strand of

DNA.

1 10 20 30 40 50 60 70 80 90 100 AcatttgcttctgacacaactgtgttcactagcaactcaaacagacaccATGGTGCACCTGACTCCTG A GGAGAAGTCTGCCGTTACTGCCCTGTGGGGC 101 AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggag 201 acagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAGA

When a cell divides, both daughter cells must receive a

complete set of genes, so the DNA molecules (chromosomes)

must replicate before division.

Asexual Reproduction (cont.)

Eukaryotes

Asexual reproduction by mitosis

G 1 S G 2 G1 + S + G2 = interphase Cell Cycle Mitosis Variable lengths. Total time 15 m inutes --> days Animal cells in culture ca. 1 day

DNA replicates during S

Gene expression occurs during G1 and G2 (and S?)

Nuclear division (mitosis) occurs during Mitosis

Cell division (cytokinesis) occurs at the end of Mitosis

Mitosis (continued) The genome is divided among a number of chromosomes.

1. Each chromosome replicates once in the S phase to produce two sister chromatids (identical DNA molecules).
2. During mitosis the the kinetochore regions of each pair of sister chromatids are attached by chromosome fibers to opposite poles of the cell.
3. Chromosome fibers contract pulling sister chromatids to opposite ends of the cell.
4. During cytokinesis the sister chromatids are partitioned one to each daughter cell.

DNA Replication is Semiconservative

**1. The strands separate.

2. A new strand is made using** each old strand as a template according to the rules of base pairing. Model proposed by Watson and Crick, verified by Matt Meselson and Frank Stahl

DNA Replication: Enzyme Activities Many enzymes are required for DNA replication. We will only consider enzyme activities, not specific enzymes. Enzymes with these activities are also used for DNA manipulation in the lab.

1. Helicase unwinds double-helical DNA. 2. Single-strand binding protein binds single strand to keep DNA unwound. 3. DNA polymerase adds new nucleotides (nucleoside triphosphates) to 3’ end of existing DNA strand (or RNA primer). Elongates chains 5 ’ to 3’ only. Arthur Kornberg

DNA Replication: Enzyme Activities

5. Exonuclease removes nucleotides from the end of a DNA strand; different enzymes work 5 ’ to 3’ or 3’ to 5’. 6. Ligase joins ends of single DNA strands by making new phosphate bonds.

Replicating Linear Chromosomes

When Replication Forks Meet

Enzyme Activities for Biotechnology These enzyme activities, plus a few others, are also used to manipulate DNA, for example:

• PCR
• Making recombinant DNA
• Detecting mutations at the molecular level

DNA Replication Details Polymerase

Replicating Circular DNA Molecules

θ Bidirectional Replication

Replicating Circular DNA Molecules

Rolling Circle Replication