


Study with the several resources on Docsity
Earn points by helping other students or get them with a premium plan
Prepare for your exams
Study with the several resources on Docsity
Earn points to download
Earn points by helping other students or get them with a premium plan
Material Type: Assignment; Class: Microbial Genetics; Subject: Molecular and Cell Biology; University: University of Illinois - Urbana-Champaign; Term: Fall 2008;
Typology: Assignments
1 / 4
This page cannot be seen from the preview
Don't miss anything!



Page 1 of 4
1. NADP is an essential cofactor for many cellular processes. Because it is not transported, exogenous NADP cannot supplement mutants unable to synthesize intracellular NADP. Five independent mutations were obtained that affect the synthesis of NADP. The properties of the mutations are described in the table below (where + indicates growth on rich medium, - indicates that no growth on rich medium, and -/+ indicates weak growth on rich medium). Row Mutation Growth temperature # 30°C 42°C 30 42°C 42 30°C 1 nad^ + + + + 2 nad-601 + - 3 nad-602 + - 4 nad-603 + - 5 nad-604 - + 6 nad-606 -/+ -/+ 7 nad-607 - + 8 nad-601 nad-602 + - + + 9 nad-601 nad-603 + - + + 10 nad-601 nad-604 - - - + 11 nad-601 nad-607 - - + - 12 nad-604 nad-607 - + + + a. Note the properties of nad-601 , nad-602 , nad-603 , nad-604 , nad-606, and nad-607 in the above Table. Indicate both whether the mutant has a conditional phenotype (temperature sensitive, cold sensitive, or non-conditional) and whether the allele is likely to be due to a missense, nonsense, frameshift, deletion, or insertion mutation? Briefly explain your answers. b. Interpret the results for each pair of double mutants in rows # 8-12. If you are not able to determine the order of the reactions catalyzed by some of the gene products from the data given, suggest a likely reason for this result. 2. You have LB (rich medium) cultures of two E. coli strains. One is a temperature sensitive (TS) leucine auxotroph and the second contains a TS mutation in the rpoA gene that codes for the alpha subunit of RNA polymerase. a.) Which mutation is most likely to affect an essential function? Why? b.) Using a simple agar plate test, how could you distinguish the two strains? Be sure to include the composition of the media you would use and the temperature(s) you would incubate the plates. c.) Which class (i.e. point mutant, deletion, insertion, etc.) are these mutants likely to be? Why?
Page 2 of 4
3. The trp operon contains five genes that are required to synthesize the amino acid tryptophan. Seven independent mutants were isolated that affected the biosynthesis of tryptophan. The growth properties of the mutants and strains with two mutations are shown in the Table below. The plates used were minimal medium lacking tryptophan. A (+) means growth, a (-) means no growth and a (+/-) means weak growth. Row # Mutation Growth temperature 30°C 42°C 30 42°C 42 30°C 1 trp+ + + + + 2 trp101 - - 3 trp102 -/+ -/+ 4 trp103 - + 5 trp104 - + 6 trp105 + - 7 trp106 + - 8 trp107 - + 9 trp103 trp104 - + 10 trp103 trp105 + - 11 trp103 trp106 + - 12 trp105 trp106 + - a). Why were plates lacking tryptophan used for these experiments? What result would you expect if plates supplemented with tryptophan were used? b). Note the properties of trp101 , t rp102 , trp103. trp104. trp105. trp106 , and trp107. Indicate whether the mutant has a conditional phenotype (temperature sensitive, cold sensitive, null) and whether the allele is likely to be due to a missense, nonsense, frameshift, deletion, or insertion mutation? Briefly explain your answers. c). Interpret the results for each pair of double mutants in rows 9 to 12. If you are unable to determine the order of some of the gene products in the tryptophan biosynthesis pathway from the data given, indicate which gene products fall into this category. d). How would you select for a revertant of trp101? 4. A diagram of the E. coli lac operon is shown below. The three gene products can be assayed independently. Many mutations in the upstream region of the lacZ gene (labeled 1) are strongly polar on expression of the lacY and lacA genes, but mutations near downstream end of the lacZ gene (labeled 2) are much less polar. Propose a molecular explanation for
Page 4 of 4 1 c. If a mutation were stimulated to revert by proflavin (an intercalating agent), what would you conclude about the mutation? d. If a mutation were stimulated to revert by hydroxylamine, what would you conclude about the mutation? [Hint: see MCF pg 192 or web supplement on mutagens.] ● How would you isolate a temperature sensitive tryptophan auxotroph of E. coli? (How could you isolate a mutant that requires tryptophan at 42°C but can grow without tryptophan at 30°C?). a. What class of mutations would such auxotrophs belong to? (i.e. deletions, insertions, etc). Why? b. How could you select a revertant that becomes temperature resistant? What medium would you use? Would the revertant necessarily be the original wild type? Why? ● ● Streisinger et al. isolated a set of frameshift mutations and intragenic suppressors in the lysozyme gene of phage T4. The sequence of part of the wild- type protein and the corresponding mutant region is shown below for two different mutants. [From CSHL Symp. Quant. Biol. (1966) 31: 77-84] Wild-type: Thr Lys Ser Pro Ser Leu Asn Ala Ala Mutant 1: Thr Lys Val His His Leu Met Ala Ala Wild-type: Thr Lys Ser Pro Ser Leu Asn Ala Ala Mutant 2: Thr Lys Ser Val His His Leu Met Ala Using the genetic code table, determine the likely nucleotide sequence of the wild-type and mutant DNA sequences, noting the position of the two frameshift mutations in the mutant genes. [Note: a genetic code table is shown on the inside cover of MCF.] ● Farabaugh et al. measured the frequency of spontaneous mutations at different sites in the lacI gene of E. coli [J. Mol. Biol. (1978) 126: 847-863]. Of 140 spontaneous mutations obtained, 37 were deletions. Of these deletions, 18 removed a specific 4 bp sequence. The DNA sequence of the region surrounding this deletion hot spot is shown below. Which base pairs are most likely to be deleted and why? [Hint: see “Deletion mutations” in the Mutants and Mutations section of the course web supplement.] TCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAA AGCCGCGCAGACGCAGACCGACCGACCGTATTT