



Study with the several resources on Docsity
Earn points by helping other students or get them with a premium plan
Prepare for your exams
Study with the several resources on Docsity
Earn points to download
Earn points by helping other students or get them with a premium plan
CLADISTICS is form of analysis that looks at features of organisms that are considered "innovations", or newer features that serve some kind of purpose. (Think ...
Typology: Exams
Limited-time offer
Uploaded on 08/05/2022
4.4
(242)3.2K documents
1 / 5
This page cannot be seen from the preview
Don't miss anything!




On special offer
1. According to your cladogram, which two species are more closely related: worms and spiders or worms and ants? How do you know? 2. According to your cladogram, what species are dragonflies most closely related to? How do you know? 3. In a different colored writing utensil, add a June Bug to your cladogram based on its characteristics. Use the following cladogram to answer the questions below. 4. What trait separates lampreys from tuna on this cladogram? 5. What separates a salamander from a turtle? 6. Which organism is most related to the leopard? 7. Which organism’s DNA will differ the most from the leopard? Why?
Worms and spiders are more closely related. They have more traits in common. Dragonflies are closely related to the flies. They have more traits in common. JAWS AMNIOTIC EGG TURTLE THE LANCELET'S DNA. IT'S THE ORGANISMS WITH LEAST TRAITS IN COMMON AND FARTHEST IN THE CLADOGRAM.
Examine the cladogram below. Each letter represents a derived characteristic. Match the letter to its characteristic.
**13. _________ Wings
Biologically, one could use anatomical features, behavior, or molecular similarities and differences in constructing a cladogram. Molecularly, one could look at the number of mutations in a common strand of DNA. Another way would be to compare strings of amino acids and note differences in the order of the amino acids. Cytochrome c is a protein located in the mitochondria of cells involved with cellular respiration. Below is a table showing the amino acid sequences for cytochrome c in several organisms. Organism Biochemical Data Amoeba Amino Acid Sequence: ISO-SER-ASP-GLN-PHE-ILE-LEU-GLN-SER-ARG-LEU-LEU-HIS DNA Sequence: ATTAGCGACCAGTTTATCCTACAATCCCGTCTACTTCAT Kangaroo Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Earthworm Amino Acid Sequence: LEU-ISO-ASP-PRO-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: CTTATCGACCCGTTTATCCTACATTCCCGTCTACCTTCGT Cat Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Shark Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Dolphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Lizard Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Sponge Amino Acid Sequence: ISO-ISO-ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT